Incidental Mutation 'R0427:Btbd9'
ID38789
Institutional Source Beutler Lab
Gene Symbol Btbd9
Ensembl Gene ENSMUSG00000062202
Gene NameBTB (POZ) domain containing 9
Synonyms1700023F20Rik
MMRRC Submission 038629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0427 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location30215524-30576287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30274942 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 492 (D492N)
Ref Sequence ENSEMBL: ENSMUSP00000127300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079924
AA Change: D492N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: D492N

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 283 405 3.9e-11 PFAM
Pfam:F5_F8_type_C 431 554 6.3e-12 PFAM
low complexity region 585 612 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168787
AA Change: D492N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: D492N

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 278 405 1.1e-8 PFAM
Pfam:F5_F8_type_C 433 554 1.4e-8 PFAM
low complexity region 585 612 N/A INTRINSIC
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Cfap74 A T 4: 155,441,277 M728L probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Kcnh3 A T 15: 99,233,299 M518L probably benign Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Med27 T C 2: 29,500,271 I70T probably damaging Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Noc3l T C 19: 38,789,651 Q773R probably benign Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr108 T A 17: 37,445,702 D60E probably damaging Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Ptpro T G 6: 137,368,296 V100G possibly damaging Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttc14 T C 3: 33,803,484 S245P probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Wipf3 T G 6: 54,483,897 L110R possibly damaging Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Btbd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd9 APN 17 30299601 missense possibly damaging 0.71
IGL01651:Btbd9 APN 17 30220417 missense unknown
IGL01814:Btbd9 APN 17 30299535 missense probably benign 0.01
IGL01820:Btbd9 APN 17 30527409 missense possibly damaging 0.82
IGL02014:Btbd9 APN 17 30517150 missense probably damaging 0.98
IGL02075:Btbd9 APN 17 30274936 nonsense probably null
IGL02390:Btbd9 APN 17 30524814 missense probably benign 0.22
IGL02414:Btbd9 APN 17 30220559 missense possibly damaging 0.95
IGL02748:Btbd9 APN 17 30334297 missense possibly damaging 0.81
crumbs UTSW 17 30299736 intron probably null
grain UTSW 17 30274942 missense possibly damaging 0.92
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0122:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0123:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0134:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0189:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0190:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0226:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0268:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0344:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0462:Btbd9 UTSW 17 30530217 missense possibly damaging 0.82
R0645:Btbd9 UTSW 17 30524967 missense probably damaging 0.96
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0974:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R1061:Btbd9 UTSW 17 30527435 missense probably benign 0.00
R1763:Btbd9 UTSW 17 30334297 missense possibly damaging 0.81
R1781:Btbd9 UTSW 17 30513593 missense probably damaging 1.00
R1902:Btbd9 UTSW 17 30530228 missense probably damaging 0.98
R1995:Btbd9 UTSW 17 30274930 missense possibly damaging 0.93
R2224:Btbd9 UTSW 17 30527346 missense probably damaging 0.98
R2237:Btbd9 UTSW 17 30334328 missense probably benign
R3684:Btbd9 UTSW 17 30334307 missense probably damaging 0.99
R3800:Btbd9 UTSW 17 30513659 missense possibly damaging 0.89
R4403:Btbd9 UTSW 17 30485932 intron probably benign
R4492:Btbd9 UTSW 17 30527571 missense probably damaging 0.99
R4654:Btbd9 UTSW 17 30485587 intron probably benign
R4854:Btbd9 UTSW 17 30524865 missense probably damaging 0.98
R5710:Btbd9 UTSW 17 30228868 missense probably benign 0.16
R5963:Btbd9 UTSW 17 30334218 splice site probably null
R6295:Btbd9 UTSW 17 30299736 intron probably null
R6422:Btbd9 UTSW 17 30530256 missense probably benign
R7023:Btbd9 UTSW 17 30527572 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCATGGGAATGCGCTTCACCTC -3'
(R):5'- TCTCCACGGCAGGTTATCTTACCAG -3'

Sequencing Primer
(F):5'- GCAGGACACTTTCGTTCTGT -3'
(R):5'- GTACACATTAGCATCCGTTGG -3'
Posted On2013-05-23