Incidental Mutation 'R0427:Olfr108'
ID38790
Institutional Source Beutler Lab
Gene Symbol Olfr108
Ensembl Gene ENSMUSG00000059687
Gene Nameolfactory receptor 108
SynonymsMOR156-5, GA_x6K02T2PSCP-1893605-1894534
MMRRC Submission 038629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0427 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37445480-37446517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37445702 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 60 (D60E)
Ref Sequence ENSEMBL: ENSMUSP00000151360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078207] [ENSMUST00000207414] [ENSMUST00000218675]
Predicted Effect probably damaging
Transcript: ENSMUST00000078207
AA Change: D49E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077337
Gene: ENSMUSG00000059687
AA Change: D49E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 33 315 8.8e-9 PFAM
Pfam:7tm_4 39 316 9.5e-54 PFAM
Pfam:7tm_1 49 298 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207414
AA Change: D60E
Predicted Effect probably damaging
Transcript: ENSMUST00000218675
AA Change: D60E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Cfap74 A T 4: 155,441,277 M728L probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Kcnh3 A T 15: 99,233,299 M518L probably benign Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Med27 T C 2: 29,500,271 I70T probably damaging Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Noc3l T C 19: 38,789,651 Q773R probably benign Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Ptpro T G 6: 137,368,296 V100G possibly damaging Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttc14 T C 3: 33,803,484 S245P probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Wipf3 T G 6: 54,483,897 L110R possibly damaging Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Olfr108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Olfr108 APN 17 37445714 missense probably benign 0.44
IGL01469:Olfr108 APN 17 37445535 missense probably benign 0.00
IGL02291:Olfr108 APN 17 37446285 missense possibly damaging 0.62
IGL02892:Olfr108 APN 17 37446034 missense probably damaging 1.00
IGL03390:Olfr108 APN 17 37446364 missense probably benign 0.02
R0115:Olfr108 UTSW 17 37445779 missense probably benign 0.00
R0395:Olfr108 UTSW 17 37445866 missense probably damaging 1.00
R0557:Olfr108 UTSW 17 37445821 missense probably damaging 1.00
R1709:Olfr108 UTSW 17 37446200 nonsense probably null
R3076:Olfr108 UTSW 17 37445484 start gained probably benign
R5467:Olfr108 UTSW 17 37446082 missense probably damaging 1.00
R5642:Olfr108 UTSW 17 37445772 missense probably damaging 1.00
R5916:Olfr108 UTSW 17 37445679 missense probably benign 0.16
R7451:Olfr108 UTSW 17 37446305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGCTGCAACTAGAGTGGTGAC -3'
(R):5'- ATAGCCATGACTGCCAGAAGCAGG -3'

Sequencing Primer
(F):5'- agtcaaacagatacacaggaaaag -3'
(R):5'- TGCCAGAAGCAGGTTATCC -3'
Posted On2013-05-23