Mutagenetix > Incidental Mutations

Incidental Mutation 'R5093:Kmt2c'

387912

Institutional Source

Beutler Lab

Gene Symbol

Kmt2c

Ensembl Gene

ENSMUSG00000038056

Gene Name

lysine (K)-specific methyltransferase 2C

Synonyms

Mll3, E330008K23Rik, HALR

MMRRC Submission

042682-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.881) question?

Stock #

R5093 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25271798-25498783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25409207 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 172 (I172F)

Ref Sequence

ENSEMBL: ENSMUSP00000134442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073] [ENSMUST00000173174]

Predicted Effect

probably benign
Transcript: ENSMUST00000045291
AA Change: I172F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: I172F

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	898	910	1.41e2	SMART
PHD	953	1002	2.89e-10	SMART
RING	954	1001	4.74e0	SMART
C1	994	1045	8.38e-2	SMART
PHD	1003	1049	1.05e-12	SMART
PHD	1080	1131	2.08e-2	SMART
low complexity region	1189	1201	N/A	INTRINSIC
low complexity region	1337	1348	N/A	INTRINSIC
low complexity region	1394	1406	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1520	1539	N/A	INTRINSIC
low complexity region	1557	1570	N/A	INTRINSIC
HMG	1639	1703	2.64e-3	SMART
low complexity region	1708	1724	N/A	INTRINSIC
coiled coil region	1745	1789	N/A	INTRINSIC
low complexity region	1847	1860	N/A	INTRINSIC
low complexity region	1864	1891	N/A	INTRINSIC
internal_repeat_3	1893	2084	1.27e-14	PROSPERO
internal_repeat_3	2123	2306	1.27e-14	PROSPERO
low complexity region	2336	2348	N/A	INTRINSIC
low complexity region	2375	2394	N/A	INTRINSIC
low complexity region	2427	2440	N/A	INTRINSIC
low complexity region	2516	2527	N/A	INTRINSIC
low complexity region	2696	2720	N/A	INTRINSIC
low complexity region	2723	2742	N/A	INTRINSIC
low complexity region	2930	2943	N/A	INTRINSIC
coiled coil region	3048	3075	N/A	INTRINSIC
low complexity region	3156	3165	N/A	INTRINSIC
low complexity region	3173	3195	N/A	INTRINSIC
coiled coil region	3226	3270	N/A	INTRINSIC
low complexity region	3277	3290	N/A	INTRINSIC
coiled coil region	3389	3427	N/A	INTRINSIC
low complexity region	3460	3486	N/A	INTRINSIC
low complexity region	3597	3611	N/A	INTRINSIC
low complexity region	3649	3667	N/A	INTRINSIC
low complexity region	3769	3783	N/A	INTRINSIC
low complexity region	3822	3827	N/A	INTRINSIC
low complexity region	3860	3869	N/A	INTRINSIC
low complexity region	3887	3904	N/A	INTRINSIC
low complexity region	3994	4009	N/A	INTRINSIC
low complexity region	4015	4038	N/A	INTRINSIC
low complexity region	4293	4309	N/A	INTRINSIC
low complexity region	4412	4419	N/A	INTRINSIC
PHD	4454	4500	2.94e-2	SMART
RING	4455	4499	8.1e0	SMART
FYRN	4554	4597	1.18e-21	SMART
FYRC	4603	4690	4.54e-32	SMART
SET	4764	4886	3.17e-34	SMART
PostSET	4888	4904	1.82e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172626

Predicted Effect

probably benign
Transcript: ENSMUST00000173073
AA Change: I172F

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056
AA Change: I172F

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	858	870	1.41e2	SMART
PHD	913	962	2.89e-10	SMART
RING	914	961	4.74e0	SMART
C1	954	1005	8.38e-2	SMART
PHD	963	1009	1.05e-12	SMART
PHD	1040	1091	2.08e-2	SMART
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1297	1308	N/A	INTRINSIC
low complexity region	1354	1366	N/A	INTRINSIC
low complexity region	1445	1464	N/A	INTRINSIC
low complexity region	1482	1495	N/A	INTRINSIC
HMG	1564	1628	2.64e-3	SMART
low complexity region	1633	1649	N/A	INTRINSIC
coiled coil region	1670	1714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173174
AA Change: I172F

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000133304
Gene: ENSMUSG00000038056
AA Change: I172F

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	775	788	N/A	INTRINSIC

Meta Mutation Damage Score

0.094

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	C	T	13: 119,474,037		probably benign	Het
Abca9	A	T	11: 110,141,532	L753Q	probably damaging	Het
Acvrl1	A	G	15: 101,134,747		probably null	Het
Adgrv1	A	T	13: 81,592,585	N141K	probably damaging	Het
Aftph	C	T	11: 20,709,619		probably null	Het
Aifm1	C	T	X: 48,482,760	G371S	probably benign	Het
Aldh3b2	A	G	19: 3,979,433	M269V	probably benign	Het
Ankrd44	T	C	1: 54,763,718	Y207C	probably damaging	Het
Arhgap15	G	T	2: 44,322,755	M412I	probably damaging	Het
Auts2	A	C	5: 131,439,458	L783R	probably damaging	Het
Baiap2l1	A	T	5: 144,278,553	Y381N	probably damaging	Het
Baiap3	T	C	17: 25,250,269	D180G	probably damaging	Het
Cant1	T	C	11: 118,411,212	Y93C	probably damaging	Het
Catsperg2	T	C	7: 29,716,998	S330G	probably benign	Het
Ccdc73	A	T	2: 105,017,766		probably benign	Het
Cdc5l	A	T	17: 45,393,041	F752L	possibly damaging	Het
Celsr2	G	T	3: 108,413,373	H708N	possibly damaging	Het
Cep170	T	A	1: 176,769,330	K487M	possibly damaging	Het
Cerkl	A	T	2: 79,333,523	N66K	probably damaging	Het
Clec11a	C	T	7: 44,304,726	A268T	probably damaging	Het
Ctnna2	C	A	6: 77,114,929		probably null	Het
Diaph3	C	A	14: 86,984,800	R416L	probably damaging	Het
Dnmbp	T	A	19: 43,849,876	N1170I	probably damaging	Het
Erbb2	G	T	11: 98,427,453	C505F	probably damaging	Het
Ercc6	T	A	14: 32,567,522	F904L	probably damaging	Het
Exo5	C	T	4: 120,922,317	G117D	probably damaging	Het
F2	CAGAAAG	CAG	2: 91,634,957		probably benign	Het
Fbxl5	A	G	5: 43,773,554	Y64H	probably damaging	Het
Gabra4	T	A	5: 71,640,864	M207L	probably damaging	Het
Galnt15	T	C	14: 32,049,829	L277P	probably damaging	Het
Gclm	T	C	3: 122,255,612		probably null	Het
Gm5493	T	A	17: 22,747,228	C29S	possibly damaging	Het
Grik3	A	G	4: 125,670,589	T455A	probably benign	Het
Grm3	A	G	5: 9,589,766	V93A	probably benign	Het
Hdgfl2	C	T	17: 56,099,217	A535V	possibly damaging	Het
Hfm1	A	T	5: 106,901,731	S455T	probably damaging	Het
Hmcn1	T	A	1: 150,737,256	D1424V	probably benign	Het
Hsd3b6	C	T	3: 98,807,804	V91I	probably benign	Het
Ick	G	A	9: 78,140,021	V68I	probably benign	Het
Igdcc4	G	A	9: 65,122,757	S363N	possibly damaging	Het
Intu	T	C	3: 40,692,917	V740A	probably benign	Het
Itga2	C	T	13: 114,856,181	V838I	probably benign	Het
Kif9	A	G	9: 110,489,897	E143G	probably damaging	Het
Kmt2d	G	A	15: 98,856,162	R21W	probably damaging	Het
Mdh1b	A	T	1: 63,711,461	D449E	probably benign	Het
Meis1	T	C	11: 18,881,785	I418V	probably benign	Het
Nags	T	A	11: 102,146,569	M162K	probably damaging	Het
Nufip1	A	G	14: 76,110,973	D14G	probably benign	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr166	T	A	16: 19,487,477	I213N	probably damaging	Het
Olfr846	T	G	9: 19,360,978	I126L	probably damaging	Het
Osmr	A	C	15: 6,821,079	V681G	probably damaging	Het
Paxip1	G	T	5: 27,766,284	Q356K	unknown	Het
Pcdhac1	T	A	18: 37,090,542	F136Y	probably damaging	Het
Pla2g6	A	G	15: 79,287,128	V699A	probably benign	Het
Plcb3	A	T	19: 6,966,210	V107E	probably damaging	Het
Plch1	T	A	3: 63,773,715	I164F	probably damaging	Het
Plpp3	A	T	4: 105,194,880	I73F	probably damaging	Het
Plscr5	G	A	9: 92,198,521	R20Q	probably benign	Het
Prdm10	G	A	9: 31,341,483	R504Q	probably damaging	Het
Prss58	T	C	6: 40,897,817	Y30C	probably damaging	Het
Psg19	T	A	7: 18,796,969	T87S	probably benign	Het
Ptpn22	T	G	3: 103,882,102	M294R	probably benign	Het
Rai1	T	A	11: 60,188,656	M1182K	probably benign	Het
Sez6	T	A	11: 77,976,562	V795D	possibly damaging	Het
Shcbp1	A	G	8: 4,739,214	V535A	possibly damaging	Het
Skint9	A	G	4: 112,389,250	Y222H	probably benign	Het
Slc13a3	T	A	2: 165,411,896	I446F	probably damaging	Het
Slc2a3	C	T	6: 122,737,237	R57H	probably damaging	Het
Slc44a4	A	G	17: 34,921,243	D208G	probably benign	Het
Spata31d1b	A	T	13: 59,716,024	N329Y	possibly damaging	Het
Strbp	C	T	2: 37,627,487	R192K	probably damaging	Het
Tctn3	A	T	19: 40,612,104	L14Q	probably damaging	Het
Tenm2	T	A	11: 36,944,162	D2V	probably damaging	Het
Tln2	T	G	9: 67,334,314	K1003T	probably benign	Het
Tmem63b	T	C	17: 45,660,874	E805G	probably damaging	Het
Trhr	A	T	15: 44,197,584	N167Y	probably damaging	Het
Trpc2	A	G	7: 102,095,183	R721G	probably benign	Het
Ttn	C	A	2: 76,870,923		probably benign	Het
Wdr91	A	G	6: 34,892,353	I412T	probably damaging	Het
Zcchc4	T	A	5: 52,796,610	S211T	probably benign	Het

Other mutations in Kmt2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Kmt2c	APN	5	25281261	missense	probably damaging	0.99
IGL00694:Kmt2c	APN	5	25293161	missense	probably damaging	0.99
IGL00780:Kmt2c	APN	5	25311051	missense	probably benign	0.00
IGL00811:Kmt2c	APN	5	25374533	missense	possibly damaging	0.75
IGL00885:Kmt2c	APN	5	25409171	missense	possibly damaging	0.80
IGL00948:Kmt2c	APN	5	25377161	missense	probably benign	0.08
IGL00959:Kmt2c	APN	5	25276229	missense	probably damaging	1.00
IGL01022:Kmt2c	APN	5	25302701	unclassified	probably benign
IGL01146:Kmt2c	APN	5	25308512	missense	probably damaging	0.96
IGL01154:Kmt2c	APN	5	25284399	missense	probably damaging	1.00
IGL01434:Kmt2c	APN	5	25409308	missense	probably damaging	1.00
IGL01464:Kmt2c	APN	5	25352244	missense	possibly damaging	0.90
IGL01525:Kmt2c	APN	5	25329441	splice site	probably benign
IGL01530:Kmt2c	APN	5	25313500	missense	probably benign	0.08
IGL01550:Kmt2c	APN	5	25281276	missense	probably damaging	1.00
IGL01598:Kmt2c	APN	5	25273666	makesense	probably null
IGL01598:Kmt2c	APN	5	25354771	missense	probably damaging	1.00
IGL01608:Kmt2c	APN	5	25354811	missense	probably damaging	0.97
IGL01663:Kmt2c	APN	5	25310670	missense	probably damaging	1.00
IGL01707:Kmt2c	APN	5	25300098	missense	probably damaging	1.00
IGL01714:Kmt2c	APN	5	25313400	missense	probably benign
IGL01784:Kmt2c	APN	5	25313526	missense	probably damaging	1.00
IGL01813:Kmt2c	APN	5	25290804	missense	possibly damaging	0.82
IGL01825:Kmt2c	APN	5	25310596	missense	probably damaging	1.00
IGL01834:Kmt2c	APN	5	25395455	missense	probably benign	0.05
IGL02072:Kmt2c	APN	5	25405432	missense	possibly damaging	0.96
IGL02159:Kmt2c	APN	5	25311343	missense	probably benign	0.18
IGL02303:Kmt2c	APN	5	25310157	missense	probably damaging	0.96
IGL02417:Kmt2c	APN	5	25373020	missense	probably benign
IGL02578:Kmt2c	APN	5	25366200	intron	probably benign
IGL02811:Kmt2c	APN	5	25315028	nonsense	probably null
IGL02943:Kmt2c	APN	5	25290823	missense	probably damaging	1.00
IGL03000:Kmt2c	APN	5	25284172	missense	probably damaging	1.00
IGL03040:Kmt2c	APN	5	25310352	missense	probably benign
IGL03076:Kmt2c	APN	5	25299151	nonsense	probably null
IGL03088:Kmt2c	APN	5	25299804	missense	probably damaging	0.99
IGL03131:Kmt2c	APN	5	25315361	missense	probably benign	0.00
FR4304:Kmt2c	UTSW	5	25315766	small insertion	probably benign
FR4976:Kmt2c	UTSW	5	25315763	small insertion	probably benign
R0313:Kmt2c	UTSW	5	25344930	missense	probably damaging	1.00
R0374:Kmt2c	UTSW	5	25309708	missense	probably damaging	1.00
R0411:Kmt2c	UTSW	5	25375957	missense	probably damaging	1.00
R0422:Kmt2c	UTSW	5	25315664	missense	probably benign
R0453:Kmt2c	UTSW	5	25354747	missense	probably damaging	1.00
R0616:Kmt2c	UTSW	5	25299252	missense	probably benign
R0619:Kmt2c	UTSW	5	25298916	missense	probably benign	0.21
R0671:Kmt2c	UTSW	5	25404365	missense	probably damaging	1.00
R0736:Kmt2c	UTSW	5	25295434	missense	probably benign
R0745:Kmt2c	UTSW	5	25359698	splice site	probably null
R0760:Kmt2c	UTSW	5	25353317	missense	possibly damaging	0.68
R0784:Kmt2c	UTSW	5	25310895	missense	probably benign	0.00
R0882:Kmt2c	UTSW	5	25295607	missense	possibly damaging	0.90
R0893:Kmt2c	UTSW	5	25351270	splice site	probably benign
R0942:Kmt2c	UTSW	5	25315303	missense	probably benign	0.10
R1110:Kmt2c	UTSW	5	25314362	missense	probably benign	0.01
R1137:Kmt2c	UTSW	5	25310983	missense	possibly damaging	0.80
R1255:Kmt2c	UTSW	5	25351153	missense	probably damaging	1.00
R1300:Kmt2c	UTSW	5	25405454	missense	probably damaging	0.99
R1497:Kmt2c	UTSW	5	25314515	missense	possibly damaging	0.80
R1594:Kmt2c	UTSW	5	25314878	missense	probably benign	0.01
R1611:Kmt2c	UTSW	5	25359311	critical splice donor site	probably null
R1617:Kmt2c	UTSW	5	25375927	missense	probably benign	0.01
R1720:Kmt2c	UTSW	5	25299184	missense	probably benign	0.05
R1723:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1724:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1726:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1736:Kmt2c	UTSW	5	25290527	missense	probably damaging	1.00
R1778:Kmt2c	UTSW	5	25372974	missense	probably benign	0.02
R1809:Kmt2c	UTSW	5	25284192	missense	probably damaging	1.00
R1845:Kmt2c	UTSW	5	25373436	missense	probably benign	0.45
R1895:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1946:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1989:Kmt2c	UTSW	5	25498544	missense	possibly damaging	0.93
R2039:Kmt2c	UTSW	5	25329040	missense	possibly damaging	0.53
R2049:Kmt2c	UTSW	5	25285079	missense	probably damaging	1.00
R2079:Kmt2c	UTSW	5	25352280	missense	possibly damaging	0.82
R2080:Kmt2c	UTSW	5	25354717	missense	probably damaging	1.00
R2107:Kmt2c	UTSW	5	25309824	missense	probably benign	0.01
R2186:Kmt2c	UTSW	5	25287112	missense	probably damaging	1.00
R2395:Kmt2c	UTSW	5	25315152	missense	probably benign
R2983:Kmt2c	UTSW	5	25315757	small deletion	probably benign
R3109:Kmt2c	UTSW	5	25275735	missense	probably damaging	1.00
R3500:Kmt2c	UTSW	5	25299479	missense	probably benign	0.02
R3738:Kmt2c	UTSW	5	25405383	missense	probably benign	0.41
R3809:Kmt2c	UTSW	5	25409138	missense	possibly damaging	0.87
R4088:Kmt2c	UTSW	5	25287713	missense	probably benign
R4107:Kmt2c	UTSW	5	25298920	missense	possibly damaging	0.51
R4212:Kmt2c	UTSW	5	25347359	critical splice donor site	probably null
R4376:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4377:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4383:Kmt2c	UTSW	5	25351062	missense	possibly damaging	0.77
R4435:Kmt2c	UTSW	5	25314877	missense	possibly damaging	0.63
R4456:Kmt2c	UTSW	5	25310212	missense	probably benign
R4461:Kmt2c	UTSW	5	25299876	missense	probably benign	0.00
R4519:Kmt2c	UTSW	5	25363477	missense	probably damaging	1.00
R4550:Kmt2c	UTSW	5	25300174	missense	probably damaging	1.00
R4557:Kmt2c	UTSW	5	25300315	missense	probably damaging	1.00
R4610:Kmt2c	UTSW	5	25354384	missense	probably damaging	1.00
R4671:Kmt2c	UTSW	5	25366177	missense	probably damaging	1.00
R4704:Kmt2c	UTSW	5	25314027	nonsense	probably null
R4781:Kmt2c	UTSW	5	25443825	missense	probably damaging	1.00
R4844:Kmt2c	UTSW	5	25315113	missense	probably benign
R4855:Kmt2c	UTSW	5	25314557	missense	probably benign	0.00
R4919:Kmt2c	UTSW	5	25314395	missense	possibly damaging	0.80
R4971:Kmt2c	UTSW	5	25310872	missense	probably benign	0.00
R4983:Kmt2c	UTSW	5	25295511	missense	possibly damaging	0.51
R5012:Kmt2c	UTSW	5	25299712	nonsense	probably null
R5033:Kmt2c	UTSW	5	25314708	missense	probably benign	0.03
R5125:Kmt2c	UTSW	5	25284381	missense	probably damaging	0.99
R5231:Kmt2c	UTSW	5	25315473	missense	possibly damaging	0.89
R5254:Kmt2c	UTSW	5	25314594	missense	probably benign	0.01
R5396:Kmt2c	UTSW	5	25294734	splice site	probably null
R5415:Kmt2c	UTSW	5	25314701	missense	probably benign	0.21
R5523:Kmt2c	UTSW	5	25299339	missense	probably benign	0.00
R5554:Kmt2c	UTSW	5	25294610	missense	probably damaging	1.00
R5701:Kmt2c	UTSW	5	25314017	missense	probably benign	0.16
R5762:Kmt2c	UTSW	5	25310457	missense	probably benign	0.01
R5819:Kmt2c	UTSW	5	25409132	critical splice donor site	probably null
R5838:Kmt2c	UTSW	5	25284471	missense	probably damaging	1.00
R5912:Kmt2c	UTSW	5	25347469	missense	possibly damaging	0.80
R5951:Kmt2c	UTSW	5	25330803	missense	probably benign	0.15
R5988:Kmt2c	UTSW	5	25311120	missense	probably benign	0.02
R5999:Kmt2c	UTSW	5	25284205	missense	probably damaging	1.00
R6104:Kmt2c	UTSW	5	25299129	missense	probably benign
R6254:Kmt2c	UTSW	5	25349874	missense	possibly damaging	0.94
R6311:Kmt2c	UTSW	5	25443818	critical splice donor site	probably null
R6329:Kmt2c	UTSW	5	25315602	missense	probably benign	0.01
R6347:Kmt2c	UTSW	5	25310835	missense	possibly damaging	0.54
R6364:Kmt2c	UTSW	5	25309636	missense	probably null	0.99
R6379:Kmt2c	UTSW	5	25359341	missense	probably damaging	1.00
R6588:Kmt2c	UTSW	5	25323789	missense	probably damaging	0.99
R6628:Kmt2c	UTSW	5	25298928	missense	probably benign
R6733:Kmt2c	UTSW	5	25409293	missense	probably damaging	1.00
R6787:Kmt2c	UTSW	5	25275739	splice site	probably null
R6816:Kmt2c	UTSW	5	25405532	splice site	probably null
R6862:Kmt2c	UTSW	5	25310517	missense	probably damaging	1.00
X0024:Kmt2c	UTSW	5	25405485	missense	probably benign	0.26
X0027:Kmt2c	UTSW	5	25330887	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GTTGGGTTAATGGTAAATCAGCAAG -3'
(R):5'- GTGCTAGAACACTTGTGTATCATG -3'

Sequencing Primer
(F):5'- GTACTGCATGGATGTGTCAAAC -3'
(R):5'- TTCTGACATCCATGGAAACCTG -3'

Posted On

2016-06-06