Incidental Mutation 'R5093:Tln2'
ID387933
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
MMRRC Submission 042682-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R5093 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67334314 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 1003 (K1003T)
Ref Sequence ENSEMBL: ENSMUSP00000148901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215784] [ENSMUST00000217550]
Predicted Effect probably benign
Transcript: ENSMUST00000039662
AA Change: K1001T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: K1001T

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040025
AA Change: K1001T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: K1001T

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215784
AA Change: K1003T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000217550
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,474,037 probably benign Het
Abca9 A T 11: 110,141,532 L753Q probably damaging Het
Acvrl1 A G 15: 101,134,747 probably null Het
Adgrv1 A T 13: 81,592,585 N141K probably damaging Het
Aftph C T 11: 20,709,619 probably null Het
Aifm1 C T X: 48,482,760 G371S probably benign Het
Aldh3b2 A G 19: 3,979,433 M269V probably benign Het
Ankrd44 T C 1: 54,763,718 Y207C probably damaging Het
Arhgap15 G T 2: 44,322,755 M412I probably damaging Het
Auts2 A C 5: 131,439,458 L783R probably damaging Het
Baiap2l1 A T 5: 144,278,553 Y381N probably damaging Het
Baiap3 T C 17: 25,250,269 D180G probably damaging Het
Cant1 T C 11: 118,411,212 Y93C probably damaging Het
Catsperg2 T C 7: 29,716,998 S330G probably benign Het
Ccdc73 A T 2: 105,017,766 probably benign Het
Cdc5l A T 17: 45,393,041 F752L possibly damaging Het
Celsr2 G T 3: 108,413,373 H708N possibly damaging Het
Cep170 T A 1: 176,769,330 K487M possibly damaging Het
Cerkl A T 2: 79,333,523 N66K probably damaging Het
Clec11a C T 7: 44,304,726 A268T probably damaging Het
Ctnna2 C A 6: 77,114,929 probably null Het
Diaph3 C A 14: 86,984,800 R416L probably damaging Het
Dnmbp T A 19: 43,849,876 N1170I probably damaging Het
Erbb2 G T 11: 98,427,453 C505F probably damaging Het
Ercc6 T A 14: 32,567,522 F904L probably damaging Het
Exo5 C T 4: 120,922,317 G117D probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Fbxl5 A G 5: 43,773,554 Y64H probably damaging Het
Gabra4 T A 5: 71,640,864 M207L probably damaging Het
Galnt15 T C 14: 32,049,829 L277P probably damaging Het
Gclm T C 3: 122,255,612 probably null Het
Gm5493 T A 17: 22,747,228 C29S possibly damaging Het
Grik3 A G 4: 125,670,589 T455A probably benign Het
Grm3 A G 5: 9,589,766 V93A probably benign Het
Hdgfl2 C T 17: 56,099,217 A535V possibly damaging Het
Hfm1 A T 5: 106,901,731 S455T probably damaging Het
Hmcn1 T A 1: 150,737,256 D1424V probably benign Het
Hsd3b6 C T 3: 98,807,804 V91I probably benign Het
Ick G A 9: 78,140,021 V68I probably benign Het
Igdcc4 G A 9: 65,122,757 S363N possibly damaging Het
Intu T C 3: 40,692,917 V740A probably benign Het
Itga2 C T 13: 114,856,181 V838I probably benign Het
Kif9 A G 9: 110,489,897 E143G probably damaging Het
Kmt2c T A 5: 25,409,207 I172F probably benign Het
Kmt2d G A 15: 98,856,162 R21W probably damaging Het
Mdh1b A T 1: 63,711,461 D449E probably benign Het
Meis1 T C 11: 18,881,785 I418V probably benign Het
Nags T A 11: 102,146,569 M162K probably damaging Het
Nufip1 A G 14: 76,110,973 D14G probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr166 T A 16: 19,487,477 I213N probably damaging Het
Olfr846 T G 9: 19,360,978 I126L probably damaging Het
Osmr A C 15: 6,821,079 V681G probably damaging Het
Paxip1 G T 5: 27,766,284 Q356K unknown Het
Pcdhac1 T A 18: 37,090,542 F136Y probably damaging Het
Pla2g6 A G 15: 79,287,128 V699A probably benign Het
Plcb3 A T 19: 6,966,210 V107E probably damaging Het
Plch1 T A 3: 63,773,715 I164F probably damaging Het
Plpp3 A T 4: 105,194,880 I73F probably damaging Het
Plscr5 G A 9: 92,198,521 R20Q probably benign Het
Prdm10 G A 9: 31,341,483 R504Q probably damaging Het
Prss58 T C 6: 40,897,817 Y30C probably damaging Het
Psg19 T A 7: 18,796,969 T87S probably benign Het
Ptpn22 T G 3: 103,882,102 M294R probably benign Het
Rai1 T A 11: 60,188,656 M1182K probably benign Het
Sez6 T A 11: 77,976,562 V795D possibly damaging Het
Shcbp1 A G 8: 4,739,214 V535A possibly damaging Het
Skint9 A G 4: 112,389,250 Y222H probably benign Het
Slc13a3 T A 2: 165,411,896 I446F probably damaging Het
Slc2a3 C T 6: 122,737,237 R57H probably damaging Het
Slc44a4 A G 17: 34,921,243 D208G probably benign Het
Spata31d1b A T 13: 59,716,024 N329Y possibly damaging Het
Strbp C T 2: 37,627,487 R192K probably damaging Het
Tctn3 A T 19: 40,612,104 L14Q probably damaging Het
Tenm2 T A 11: 36,944,162 D2V probably damaging Het
Tmem63b T C 17: 45,660,874 E805G probably damaging Het
Trhr A T 15: 44,197,584 N167Y probably damaging Het
Trpc2 A G 7: 102,095,183 R721G probably benign Het
Ttn C A 2: 76,870,923 probably benign Het
Wdr91 A G 6: 34,892,353 I412T probably damaging Het
Zcchc4 T A 5: 52,796,610 S211T probably benign Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1847:Tln2 UTSW 9 67362687 nonsense probably null
R1964:Tln2 UTSW 9 67342135 missense probably benign 0.00
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2201:Tln2 UTSW 9 67375757 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3151:Tln2 UTSW 9 67330547 critical splice donor site probably null
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4450:Tln2 UTSW 9 67344065 critical splice donor site probably null
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6106:Tln2 UTSW 9 67323020 missense probably damaging 0.99
R6175:Tln2 UTSW 9 67224081 missense probably damaging 1.00
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAAGCTGAAGTGCTGACC -3'
(R):5'- CAATGATAACCCTTAGACTAGTGACAC -3'

Sequencing Primer
(F):5'- CTGAAGTGCTGACCACCAGAG -3'
(R):5'- GCAAGGCTCCACTTTGTAAACG -3'
Posted On2016-06-06