Incidental Mutation 'R0432:Ahctf1'
ID38799
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene NameAT hook containing transcription factor 1
Synonyms6230412P20Rik, Elys
MMRRC Submission 038634-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0432 (G1)
Quality Score211
Status Validated
Chromosome1
Chromosomal Location179744894-179803680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 179784161 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 548 (I548R)
Ref Sequence ENSEMBL: ENSMUSP00000027768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768]
PDB Structure
Nucleoporin ELYS (aa1-494), Mus musculus [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027768
AA Change: I548R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: I548R

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 99% (91/92)
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,816 L110P probably damaging Het
4930522L14Rik A T 5: 109,736,919 C358S probably damaging Het
9330182L06Rik G T 5: 9,440,966 G659* probably null Het
Abca8b C A 11: 109,980,015 V104F possibly damaging Het
Afap1l2 T C 19: 56,917,119 probably benign Het
Alox12b G T 11: 69,169,556 G646V probably damaging Het
Aoah C T 13: 20,911,198 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Atxn1l A G 8: 109,731,693 W646R probably damaging Het
Cabp2 T C 19: 4,084,903 I28T possibly damaging Het
Cacna1b G A 2: 24,687,704 T719I probably damaging Het
Camk1d A T 2: 5,445,135 H70Q probably damaging Het
Car1 T C 3: 14,770,176 T170A probably benign Het
Ccdc162 T C 10: 41,541,860 T2113A probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh17 T A 4: 11,771,273 C18* probably null Het
Cdk17 A T 10: 93,237,790 probably benign Het
Chd9 T A 8: 90,994,450 probably benign Het
Chrm5 T A 2: 112,479,655 K372M possibly damaging Het
Clasp2 A G 9: 113,909,419 T423A probably benign Het
Col11a1 A G 3: 114,205,901 probably benign Het
Col27a1 T C 4: 63,225,611 M512T possibly damaging Het
Dclk3 A G 9: 111,484,935 D693G probably damaging Het
Dcun1d3 T A 7: 119,857,950 K180* probably null Het
Dmxl2 T C 9: 54,416,951 R876G probably benign Het
Dnmbp A T 19: 43,854,857 Y432* probably null Het
Eml2 C T 7: 19,179,531 Q125* probably null Het
Faap100 A C 11: 120,373,876 probably benign Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gda A G 19: 21,417,107 Y129H probably damaging Het
Gga3 G A 11: 115,590,524 R207C probably damaging Het
Glg1 T C 8: 111,182,569 I496M probably damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10322 A T 10: 59,616,208 H49L possibly damaging Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Gramd3 G A 18: 56,474,069 C85Y probably benign Het
Grhl1 C T 12: 24,582,919 P153L probably benign Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hdlbp T C 1: 93,425,332 I414V probably damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Lipe G A 7: 25,398,488 P10L probably benign Het
Lrrc8a A G 2: 30,257,067 E631G probably damaging Het
Lvrn T A 18: 46,905,299 N973K possibly damaging Het
Man2c1 T A 9: 57,135,597 H250Q probably damaging Het
Mup3 T C 4: 62,085,282 T117A probably benign Het
Myo6 A C 9: 80,273,974 probably benign Het
Nbn T A 4: 15,983,951 probably benign Het
Ncapg T A 5: 45,672,428 N157K probably damaging Het
Olfr1024 T A 2: 85,904,157 N299I probably damaging Het
Olfr1137 G A 2: 87,711,430 H159Y probably benign Het
Olfr1154 T C 2: 87,902,960 T239A probably damaging Het
Olfr1178 C T 2: 88,392,033 T262I probably damaging Het
Olfr1434 T A 19: 12,283,903 M285K probably damaging Het
P4ha1 T A 10: 59,348,257 Y180* probably null Het
Pcdhb19 T A 18: 37,499,535 F794L probably benign Het
Pdxdc1 T A 16: 13,854,400 I379F probably damaging Het
Psme3 T A 11: 101,320,442 S185T possibly damaging Het
Ptgr1 A G 4: 58,978,045 S116P probably damaging Het
Ptpn23 A T 9: 110,389,010 probably null Het
Rabgap1l A C 1: 160,722,205 I277R probably benign Het
Rapgef1 C T 2: 29,679,816 T93I possibly damaging Het
Rbp3 A T 14: 33,954,773 D226V probably damaging Het
Rnf144a A T 12: 26,339,329 C38S probably damaging Het
Rptor C T 11: 119,780,553 Q281* probably null Het
Rragd T C 4: 33,004,332 L208S probably damaging Het
Slc12a4 T C 8: 105,959,488 E41G probably damaging Het
Slc16a1 G T 3: 104,653,419 V347F probably benign Het
Slit1 G A 19: 41,743,293 T39I probably damaging Het
Sra1 T C 18: 36,677,503 N98S probably benign Het
Ssx2ip T C 3: 146,426,429 L215P probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Tep1 TTTCTTCTTCTT TTTCTTCTT 14: 50,866,823 probably benign Het
Tgfbi T C 13: 56,632,191 probably benign Het
Tmem232 T C 17: 65,256,503 M632V probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnnt3 T G 7: 142,512,086 D153E probably benign Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Tpsab1 A G 17: 25,343,824 probably benign Het
Usp34 T A 11: 23,401,505 V1431D probably damaging Het
Wdr49 G T 3: 75,450,022 R285S possibly damaging Het
Wdr7 A G 18: 63,796,249 Y1052C probably damaging Het
Zan A T 5: 137,382,316 probably benign Het
Zfp652 G A 11: 95,763,739 V323I possibly damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zfp874b A G 13: 67,481,836 S10P probably damaging Het
Zmynd19 A G 2: 24,958,122 Y110C probably benign Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179769131 missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179795877 missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179753322 missense probably benign
IGL01997:Ahctf1 APN 1 179755462 missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179766014 missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179779652 missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179753078 missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179752479 missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179776015 missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179792451 missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179769034 missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179776011 nonsense probably null
IGL02895:Ahctf1 APN 1 179793811 missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179775330 critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179788202 missense probably benign 0.01
cerebro UTSW 1 179769414 missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179763473 missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179760271 missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179763468 critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179769414 missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179762908 missense probably benign 0.26
R1055:Ahctf1 UTSW 1 179763486 missense possibly damaging 0.46
R1473:Ahctf1 UTSW 1 179776108 missense probably benign 0.30
R1473:Ahctf1 UTSW 1 179799279 missense probably damaging 0.99
R1689:Ahctf1 UTSW 1 179768383 missense probably damaging 0.96
R1778:Ahctf1 UTSW 1 179753015 missense possibly damaging 0.57
R1878:Ahctf1 UTSW 1 179775509 missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179770653 missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179795796 missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179770693 missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179752532 missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179753870 missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179755583 missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179777780 missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179762616 missense possibly damaging 0.61
R4681:Ahctf1 UTSW 1 179752796 missense probably benign 0.27
R4695:Ahctf1 UTSW 1 179753054 missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179753399 missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179799357 unclassified probably benign
R4898:Ahctf1 UTSW 1 179755512 missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179748627 missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179786784 missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179793594 intron probably benign
R5319:Ahctf1 UTSW 1 179769050 missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179770634 nonsense probably null
R5546:Ahctf1 UTSW 1 179754068 missense probably benign 0.01
R5718:Ahctf1 UTSW 1 179769339 missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179788330 missense probably damaging 1.00
R5958:Ahctf1 UTSW 1 179746542 unclassified probably benign
R6010:Ahctf1 UTSW 1 179795813 missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179781672 missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179762952 missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179777390 intron probably null
R6268:Ahctf1 UTSW 1 179763483 missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179753513 missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179752407 missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179752634 missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179753288 missense probably benign 0.04
R6998:Ahctf1 UTSW 1 179770915 nonsense probably null
R7082:Ahctf1 UTSW 1 179775333 missense probably benign 0.15
R7385:Ahctf1 UTSW 1 179753381 missense possibly damaging 0.66
R7414:Ahctf1 UTSW 1 179784105 missense probably benign 0.00
X0067:Ahctf1 UTSW 1 179777704 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATATTCACACTGGGGTGAAGCTGG -3'
(R):5'- TGGGGTTTCCCACTTCTTACAATGC -3'

Sequencing Primer
(F):5'- TGGTACAGAGCATCACAGATTC -3'
(R):5'- ACAGCCAAATGAGCCTCAGA -3'
Posted On2013-05-23