Incidental Mutation 'R5096:Olfr638'
ID388043
Institutional Source Beutler Lab
Gene Symbol Olfr638
Ensembl Gene ENSMUSG00000094063
Gene Nameolfactory receptor 638
SynonymsMOR5-1, GA_x6K02T2PBJ9-6737723-6738670
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5096 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103998746-104004357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104003460 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 68 (Y68H)
Ref Sequence ENSEMBL: ENSMUSP00000148160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138055] [ENSMUST00000209757] [ENSMUST00000215653] [ENSMUST00000218325]
Predicted Effect probably benign
Transcript: ENSMUST00000098184
AA Change: Y68H

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095786
Gene: ENSMUSG00000094063
AA Change: Y68H

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 2.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 198 9.8e-10 PFAM
Pfam:7tm_1 49 300 7.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209757
AA Change: Y68H

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215653
Predicted Effect probably benign
Transcript: ENSMUST00000218325
AA Change: Y62H

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Olfr638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Olfr638 APN 7 104003635 missense probably damaging 1.00
IGL01901:Olfr638 APN 7 104004067 missense probably damaging 1.00
IGL02040:Olfr638 APN 7 104003407 missense probably damaging 1.00
IGL02756:Olfr638 APN 7 104003659 missense probably damaging 1.00
R0122:Olfr638 UTSW 7 104003358 missense probably damaging 1.00
R0137:Olfr638 UTSW 7 104003502 missense probably benign 0.13
R0312:Olfr638 UTSW 7 104004025 missense probably damaging 1.00
R0650:Olfr638 UTSW 7 104003239 splice site probably null
R0652:Olfr638 UTSW 7 104003239 splice site probably null
R1382:Olfr638 UTSW 7 104003720 missense probably benign 0.01
R1700:Olfr638 UTSW 7 104004122 nonsense probably null
R1723:Olfr638 UTSW 7 104003311 missense probably damaging 0.97
R1745:Olfr638 UTSW 7 104004063 missense probably benign 0.02
R1840:Olfr638 UTSW 7 104004117 missense probably benign 0.00
R3408:Olfr638 UTSW 7 104003343 nonsense probably null
R3413:Olfr638 UTSW 7 104003832 missense probably damaging 0.99
R4441:Olfr638 UTSW 7 104004072 missense probably damaging 1.00
R4727:Olfr638 UTSW 7 104003890 missense probably benign 0.00
R5851:Olfr638 UTSW 7 104003452 missense probably benign 0.13
R6133:Olfr638 UTSW 7 104003325 missense possibly damaging 0.58
R6529:Olfr638 UTSW 7 104003926 missense probably benign 0.06
R6572:Olfr638 UTSW 7 103999184 intron probably null
R6799:Olfr638 UTSW 7 103998799 critical splice donor site probably null
X0018:Olfr638 UTSW 7 104003431 missense probably benign
X0063:Olfr638 UTSW 7 104003527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCGTCCATCAAGTATGTCAG -3'
(R):5'- AGATGGCCACATAACGGTC -3'

Sequencing Primer
(F):5'- CGTCCATCAAGTATGTCAGAAGTAAC -3'
(R):5'- CATAACGGTCAAAGGACATGGCC -3'
Posted On2016-06-06