Incidental Mutation 'R5096:Grhl1'
ID388050
Institutional Source Beutler Lab
Gene Symbol Grhl1
Ensembl Gene ENSMUSG00000020656
Gene Namegrainyhead like transcription factor 1
SynonymsLBP-32, p70 MGR, p61 MGR, Tcfcp2l2
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5096 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location24572283-24617391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24603050 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 418 (K418M)
Ref Sequence ENSEMBL: ENSMUSP00000082689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020985] [ENSMUST00000085553]
Predicted Effect probably damaging
Transcript: ENSMUST00000020985
AA Change: K336M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020985
Gene: ENSMUSG00000020656
AA Change: K336M

DomainStartEndE-ValueType
Pfam:CP2 133 362 1.8e-87 PFAM
low complexity region 406 421 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085553
AA Change: K418M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082689
Gene: ENSMUSG00000020656
AA Change: K418M

DomainStartEndE-ValueType
Pfam:CP2 228 442 1.9e-82 PFAM
low complexity region 488 503 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223442
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display alopecia or sparse hair, abnormal hair follicle root sheaths, thickening of the cornified layer on the paws, and postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Grhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Grhl1 APN 12 24612170 missense probably damaging 1.00
IGL01104:Grhl1 APN 12 24584454 missense probably damaging 1.00
IGL01335:Grhl1 APN 12 24608058 missense probably damaging 1.00
IGL01660:Grhl1 APN 12 24608578 splice site probably null
IGL01725:Grhl1 APN 12 24609748 splice site probably benign
IGL02869:Grhl1 APN 12 24581491 missense probably damaging 1.00
bandit UTSW 12 24578027 missense probably benign 0.31
R0048:Grhl1 UTSW 12 24612151 splice site probably benign
R0373:Grhl1 UTSW 12 24581515 missense probably benign 0.00
R0432:Grhl1 UTSW 12 24582919 missense probably benign 0.29
R0442:Grhl1 UTSW 12 24612170 missense probably damaging 1.00
R1531:Grhl1 UTSW 12 24582963 critical splice donor site probably null
R1646:Grhl1 UTSW 12 24611861 missense possibly damaging 0.64
R1874:Grhl1 UTSW 12 24586156 splice site probably benign
R1892:Grhl1 UTSW 12 24584910 missense probably damaging 1.00
R1908:Grhl1 UTSW 12 24608556 missense probably damaging 0.99
R2051:Grhl1 UTSW 12 24586152 critical splice donor site probably null
R2199:Grhl1 UTSW 12 24612170 missense probably damaging 1.00
R2233:Grhl1 UTSW 12 24608511 missense probably damaging 0.98
R3803:Grhl1 UTSW 12 24584919 missense probably damaging 1.00
R3864:Grhl1 UTSW 12 24615930 makesense probably null
R4227:Grhl1 UTSW 12 24611851 missense probably benign
R4682:Grhl1 UTSW 12 24608433 missense probably benign 0.00
R4709:Grhl1 UTSW 12 24586133 missense possibly damaging 0.57
R5149:Grhl1 UTSW 12 24612179 small deletion probably benign
R5580:Grhl1 UTSW 12 24609740 missense probably benign 0.00
R6035:Grhl1 UTSW 12 24608450 missense probably benign 0.00
R6035:Grhl1 UTSW 12 24608450 missense probably benign 0.00
R6110:Grhl1 UTSW 12 24580747 unclassified probably null
R6351:Grhl1 UTSW 12 24584858 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCTGTCATGTCAGCATTTGC -3'
(R):5'- GGGGCCACATCCTTTACTTTAC -3'

Sequencing Primer
(F):5'- ATGTCAGCATTTGCAAGGCC -3'
(R):5'- GGCCACATCCTTTACTTTACCAGAC -3'
Posted On2016-06-06