Incidental Mutation 'R5097:Akt3'
List |< first << previous [record 87 of 1871] next >> last >|
ID388062
Institutional Source Beutler Lab
Gene Symbol Akt3
Ensembl Gene ENSMUSG00000019699
Gene Namethymoma viral proto-oncogene 3
SynonymsD930002M15Rik, Nmf350, PKB gamma
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location177020073-177258203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 177248688 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 12 (V12L)
Ref Sequence ENSEMBL: ENSMUSP00000106790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019843] [ENSMUST00000111159] [ENSMUST00000111160]
Predicted Effect probably benign
Transcript: ENSMUST00000019843
AA Change: V12L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000019843
Gene: ENSMUSG00000019699
AA Change: V12L

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 467 6.37e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111159
AA Change: V12L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106789
Gene: ENSMUSG00000019699
AA Change: V12L

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111160
AA Change: V12L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106790
Gene: ENSMUSG00000019699
AA Change: V12L

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211158
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. Mice heterozygous for an ENU-induced mutation exhibit increased seizures (sporadic and induced) and increased brain weight and size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Akt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Akt3 APN 1 177130967 splice site probably benign
IGL02348:Akt3 APN 1 177059386 missense probably damaging 0.99
IGL02394:Akt3 APN 1 177059419 missense probably damaging 1.00
IGL03005:Akt3 APN 1 177067227 missense probably damaging 1.00
R0114:Akt3 UTSW 1 177067251 missense probably damaging 1.00
R1403:Akt3 UTSW 1 177131110 splice site probably benign
R1452:Akt3 UTSW 1 177131067 missense possibly damaging 0.93
R1495:Akt3 UTSW 1 177103042 missense probably benign
R1961:Akt3 UTSW 1 177096995 missense probably damaging 0.97
R2062:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2064:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2066:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2068:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R4155:Akt3 UTSW 1 177096977 missense possibly damaging 0.92
R4937:Akt3 UTSW 1 177050127 missense possibly damaging 0.89
R5414:Akt3 UTSW 1 177050251 missense probably damaging 0.98
R6336:Akt3 UTSW 1 177031712 missense probably damaging 1.00
R6723:Akt3 UTSW 1 177050190 nonsense probably null
R6752:Akt3 UTSW 1 177050190 nonsense probably null
R6753:Akt3 UTSW 1 177050190 nonsense probably null
R6755:Akt3 UTSW 1 177050190 nonsense probably null
R6765:Akt3 UTSW 1 177050190 nonsense probably null
R6766:Akt3 UTSW 1 177050190 nonsense probably null
R6767:Akt3 UTSW 1 177050190 nonsense probably null
R6782:Akt3 UTSW 1 177050190 nonsense probably null
R6787:Akt3 UTSW 1 177050190 nonsense probably null
R6847:Akt3 UTSW 1 177031659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTAAATGTAAGCCCTCGCC -3'
(R):5'- AGGCTGAGTCATCACTAGAGAG -3'

Sequencing Primer
(F):5'- CTGTAAAGTCTGTTGAATCTGAAGAC -3'
(R):5'- CTAGAGAGTGGGAAGGGCG -3'
Posted On2016-06-06