Incidental Mutation 'R5097:Ak5'
ID388069
Institutional Source Beutler Lab
Gene Symbol Ak5
Ensembl Gene ENSMUSG00000039058
Gene Nameadenylate kinase 5
Synonyms
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152462815-152668360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152481633 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 406 (S406P)
Ref Sequence ENSEMBL: ENSMUSP00000042785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045262]
Predicted Effect probably damaging
Transcript: ENSMUST00000045262
AA Change: S406P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042785
Gene: ENSMUSG00000039058
AA Change: S406P

DomainStartEndE-ValueType
Pfam:AAA_17 134 263 1.1e-8 PFAM
Pfam:AAA_18 135 274 3e-10 PFAM
Pfam:ADK 137 294 5.8e-35 PFAM
Pfam:AAA_17 378 525 2.9e-8 PFAM
Pfam:ADK 381 537 1.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198552
Predicted Effect unknown
Transcript: ENSMUST00000200062
AA Change: S64P
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylate kinase family, which is involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. This member is related to the UMP/CMP kinase of several species. It is located in the cytosol and expressed exclusively in brain. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Ak5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02178:Ak5 APN 3 152526785 missense probably benign 0.28
IGL02237:Ak5 APN 3 152499343 missense probably benign 0.44
IGL02661:Ak5 APN 3 152463956 missense probably benign
IGL03097:Ak5 UTSW 3 152660514 critical splice donor site probably null
R0645:Ak5 UTSW 3 152653615 missense probably damaging 1.00
R1135:Ak5 UTSW 3 152653662 missense probably damaging 1.00
R1346:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1347:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1347:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1349:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1749:Ak5 UTSW 3 152472920 missense probably damaging 0.99
R2059:Ak5 UTSW 3 152660637 missense probably damaging 1.00
R3929:Ak5 UTSW 3 152667807 missense probably damaging 0.98
R4433:Ak5 UTSW 3 152655880 missense probably damaging 1.00
R4909:Ak5 UTSW 3 152655877 missense probably damaging 1.00
R5052:Ak5 UTSW 3 152660567 missense probably benign 0.00
R5645:Ak5 UTSW 3 152656033 missense possibly damaging 0.92
R5907:Ak5 UTSW 3 152615952 missense probably damaging 1.00
R6505:Ak5 UTSW 3 152481669 missense probably benign 0.01
R7117:Ak5 UTSW 3 152615856 critical splice donor site probably null
X0023:Ak5 UTSW 3 152616027 missense probably damaging 1.00
X0024:Ak5 UTSW 3 152653597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCCATGATCCAGCCTG -3'
(R):5'- TGAGTCTCTACAGCGCACATG -3'

Sequencing Primer
(F):5'- ATCCAGCCTGCCACCGTAG -3'
(R):5'- GTCTCTACAGCGCACATGATCAAC -3'
Posted On2016-06-06