Incidental Mutation 'R5097:Clgn'
ID388091
Institutional Source Beutler Lab
Gene Symbol Clgn
Ensembl Gene ENSMUSG00000002190
Gene Namecalmegin
Synonyms4930459O04Rik, A2/6, Cln, calnexin-t
MMRRC Submission 042686-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83389867-83428552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83410523 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 290 (V290F)
Ref Sequence ENSEMBL: ENSMUSP00000105457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002259] [ENSMUST00000109831]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002259
AA Change: V290F

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002259
Gene: ENSMUSG00000002190
AA Change: V290F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 62 429 6.6e-160 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109831
AA Change: V290F

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105457
Gene: ENSMUSG00000002190
AA Change: V290F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 60 429 1.9e-154 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the calreticulin family, which includes calreticulin, calnexin, and calmegin, and encodes a calcium-binding molecular chaperone specifically expressed in pachytene stage male germ cells. It is required for the proper folding of newly synthesized membrane proteins in the endoplasmic reticulum including those critical for sperm migration from the uterus into the oviduct and sperm adhesion to and penetration of the zona pellucida. This gene plays a key role in spermatogenesis and male infertility. Alternative splice variants exist for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit severely impaired fertility associated with an apparent defect in either sperm/zona pellucida binding and/or sperm transit to the oviduct. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myh11 C T 16: 14,205,906 probably null Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Clgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Clgn APN 8 83397650 missense probably damaging 1.00
IGL02158:Clgn APN 8 83423136 missense probably damaging 1.00
IGL03077:Clgn APN 8 83424140 missense probably benign 0.05
PIT4260001:Clgn UTSW 8 83423124 missense probably damaging 0.99
R0604:Clgn UTSW 8 83424194 missense probably benign 0.01
R1728:Clgn UTSW 8 83423030 missense probably damaging 0.98
R1729:Clgn UTSW 8 83423030 missense probably damaging 0.98
R2059:Clgn UTSW 8 83399978 missense probably benign 0.01
R2182:Clgn UTSW 8 83410410 missense possibly damaging 0.80
R3821:Clgn UTSW 8 83420477 missense probably null 0.02
R4542:Clgn UTSW 8 83420209 missense probably damaging 1.00
R5677:Clgn UTSW 8 83409538 missense probably damaging 1.00
R5752:Clgn UTSW 8 83397041 missense probably damaging 0.99
R5802:Clgn UTSW 8 83425614 missense probably damaging 1.00
R6584:Clgn UTSW 8 83400036 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTTTAGTGATGAATCCGGATGATAC -3'
(R):5'- CTCATGGATCTTCCCACAGAAC -3'

Sequencing Primer
(F):5'- TGAATCCGGATGATACATTTGAAG -3'
(R):5'- TGGATCTTCCCACAGAACTGATATC -3'
Posted On2016-06-06