Incidental Mutation 'R5097:Myh11'
ID388106
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Namemyosin, heavy polypeptide 11, smooth muscle
SynonymssmMHC, SM1, SM2
MMRRC Submission 042686-MU
Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5097 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location14194535-14291372 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 14205906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
Predicted Effect probably null
Transcript: ENSMUST00000090287
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000230397
Predicted Effect probably null
Transcript: ENSMUST00000231567
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,693,050 V805F probably damaging Het
Adgrb3 G A 1: 25,826,084 T226M probably damaging Het
Ak5 A G 3: 152,481,633 S406P probably damaging Het
Akt3 C G 1: 177,248,688 V12L probably benign Het
Arhgef40 A C 14: 51,989,689 S397R probably damaging Het
Atp5c1 A G 2: 10,063,512 V144A probably benign Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Clgn G T 8: 83,410,523 V290F possibly damaging Het
Dis3l T A 9: 64,319,216 D261V probably damaging Het
Dnah11 T A 12: 118,017,700 Y2577F probably damaging Het
Evi5l A G 8: 4,193,317 E371G probably damaging Het
Fat2 A G 11: 55,310,704 S515P probably damaging Het
Fsip2 A G 2: 82,991,985 I6021V probably benign Het
Gm813 A C 16: 58,613,864 N163K probably benign Het
Gstm5 A T 3: 107,895,942 probably benign Het
H2-Oa G A 17: 34,093,835 D29N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ireb2 A G 9: 54,895,384 I434M probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Micall1 A G 15: 79,129,878 T658A probably benign Het
Mitf C T 6: 97,996,462 A252V possibly damaging Het
Mpzl1 A G 1: 165,605,716 I122T probably damaging Het
Mtus2 G A 5: 148,295,582 V146I probably damaging Het
Myrfl A G 10: 116,817,704 I486T probably damaging Het
N4bp2 T C 5: 65,817,218 V1477A probably damaging Het
Ndc1 T A 4: 107,374,161 S100T probably benign Het
Nek10 T A 14: 14,857,851 N433K probably benign Het
Noc4l C T 5: 110,651,346 S190N probably benign Het
Nprl2 A G 9: 107,543,532 E122G probably damaging Het
Olfr1 G C 11: 73,395,293 S243C probably damaging Het
Olfr430 C T 1: 174,069,529 T77I probably benign Het
Olfr525 A G 7: 140,323,095 Y132C probably damaging Het
Osbpl1a T C 18: 12,763,537 I324V probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg3 C T 7: 6,710,027 R732H probably damaging Het
Rfc4 A G 16: 23,114,296 I297T possibly damaging Het
Rpl3l T A 17: 24,733,461 D218E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sesn2 C T 4: 132,496,898 V400I probably benign Het
Syt11 C T 3: 88,747,924 V51I probably benign Het
Tas2r115 A C 6: 132,737,253 L245R probably damaging Het
Tmem115 G A 9: 107,534,860 V128I probably benign Het
Trim47 A G 11: 116,106,434 V499A probably benign Het
Trpm7 A T 2: 126,796,336 probably null Het
Zfp143 A G 7: 110,088,791 D479G probably damaging Het
Zfp292 T C 4: 34,839,878 T91A possibly damaging Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14277722 missense probably benign 0.00
IGL01398:Myh11 APN 16 14202100 missense probably damaging 0.99
IGL01646:Myh11 APN 16 14221775 missense probably damaging 1.00
IGL02470:Myh11 APN 16 14218046 missense probably damaging 1.00
IGL02680:Myh11 APN 16 14209520 missense probably benign 0.02
IGL02687:Myh11 APN 16 14212618 nonsense probably null
IGL02987:Myh11 APN 16 14232532 missense probably damaging 1.00
IGL03008:Myh11 APN 16 14204753 missense probably benign 0.00
G5030:Myh11 UTSW 16 14250579 missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14201066 missense
R0008:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0085:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0086:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0087:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14211260 missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14218880 missense probably benign 0.32
R0546:Myh11 UTSW 16 14205628 missense probably damaging 1.00
R0658:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0715:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14203178 missense probably damaging 1.00
R1014:Myh11 UTSW 16 14236410 missense possibly damaging 0.70
R1104:Myh11 UTSW 16 14202127 missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14205931 nonsense probably null
R1560:Myh11 UTSW 16 14226620 nonsense probably null
R1714:Myh11 UTSW 16 14236368 critical splice donor site probably null
R1742:Myh11 UTSW 16 14220044 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14200758 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14215790 missense probably damaging 0.98
R1753:Myh11 UTSW 16 14277870 missense probably benign
R1760:Myh11 UTSW 16 14233695 splice site probably benign
R1829:Myh11 UTSW 16 14223880 missense probably damaging 1.00
R1876:Myh11 UTSW 16 14269103 splice site probably benign
R2027:Myh11 UTSW 16 14232668 missense probably damaging 1.00
R2122:Myh11 UTSW 16 14218004 missense probably damaging 1.00
R2247:Myh11 UTSW 16 14277559 missense probably damaging 1.00
R2495:Myh11 UTSW 16 14205557 missense probably damaging 1.00
R2863:Myh11 UTSW 16 14239426 missense probably benign 0.02
R3684:Myh11 UTSW 16 14203234 missense probably benign 0.00
R3693:Myh11 UTSW 16 14217949 missense probably benign 0.01
R4080:Myh11 UTSW 16 14224059 missense possibly damaging 0.83
R4367:Myh11 UTSW 16 14218883 missense probably damaging 0.97
R4664:Myh11 UTSW 16 14226584 missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14269241 missense probably damaging 0.99
R4694:Myh11 UTSW 16 14200702 missense probably damaging 1.00
R4805:Myh11 UTSW 16 14234465 missense possibly damaging 0.61
R4806:Myh11 UTSW 16 14201083 splice site probably null
R4905:Myh11 UTSW 16 14250523 missense probably benign 0.13
R4939:Myh11 UTSW 16 14239507 missense probably benign
R4964:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R4966:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R5029:Myh11 UTSW 16 14205625 missense probably damaging 1.00
R5045:Myh11 UTSW 16 14239527 nonsense probably null
R5288:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14244855 missense probably damaging 0.96
R5856:Myh11 UTSW 16 14205976 missense probably benign 0.00
R5869:Myh11 UTSW 16 14230800 missense probably damaging 1.00
R6019:Myh11 UTSW 16 14206074 missense probably damaging 1.00
R6024:Myh11 UTSW 16 14277703 missense probably damaging 0.99
R6139:Myh11 UTSW 16 14215874 missense probably damaging 1.00
R6209:Myh11 UTSW 16 14208291 nonsense probably null
R6373:Myh11 UTSW 16 14205130 missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14205553 missense probably damaging 1.00
R6709:Myh11 UTSW 16 14223494 critical splice donor site probably null
R7069:Myh11 UTSW 16 14218939 missense possibly damaging 0.95
X0018:Myh11 UTSW 16 14277633 missense probably damaging 1.00
X0025:Myh11 UTSW 16 14209689 missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14234402 missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14269262 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCCAGTTCATGCACCTAGTAAG -3'
(R):5'- TCCTCCAAGTATGCGGATGAG -3'

Sequencing Primer
(F):5'- GTTCATGCACCTAGTAAGCAGAATG -3'
(R):5'- CTCCAAGTATGCGGATGAGAGAGAC -3'
Posted On2016-06-06