Incidental Mutation 'R0432:Wdr49'
ID38812
Institutional Source Beutler Lab
Gene Symbol Wdr49
Ensembl Gene ENSMUSG00000104301
Gene NameWD repeat domain 49
SynonymsEG213248
MMRRC Submission 038634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0432 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location75274988-75482156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75450022 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 285 (R285S)
Ref Sequence ENSEMBL: ENSMUSP00000144789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000193989] [ENSMUST00000203169] [ENSMUST00000204341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178270
AA Change: R222S

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137584
Gene: ENSMUSG00000095162
AA Change: R222S

DomainStartEndE-ValueType
WD40 73 113 3.18e1 SMART
WD40 115 161 2.74e2 SMART
WD40 249 290 7.92e1 SMART
WD40 295 333 1.99e0 SMART
WD40 337 376 3.05e-4 SMART
Blast:WD40 423 448 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193989
SMART Domains Protein: ENSMUSP00000144721
Gene: ENSMUSG00000104301

DomainStartEndE-ValueType
WD40 17 55 1.3e-2 SMART
WD40 59 98 2e-6 SMART
WD40 145 184 2.5e-2 SMART
WD40 187 228 3.6e-8 SMART
WD40 281 318 8.7e-6 SMART
WD40 365 412 2.2e-1 SMART
WD40 415 455 8.4e-4 SMART
WD40 471 512 3.1e-2 SMART
Blast:SERPIN 608 673 7e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000203169
AA Change: R285S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144789
Gene: ENSMUSG00000104301
AA Change: R285S

DomainStartEndE-ValueType
WD40 136 176 2e-1 SMART
WD40 178 224 1.8e0 SMART
WD40 312 353 5.1e-1 SMART
WD40 358 396 1.3e-2 SMART
WD40 400 439 2e-6 SMART
Blast:WD40 486 511 1e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000204341
AA Change: R222S

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145379
Gene: ENSMUSG00000104301
AA Change: R222S

DomainStartEndE-ValueType
WD40 73 113 3.18e1 SMART
WD40 115 161 2.74e2 SMART
WD40 249 290 7.92e1 SMART
WD40 295 333 1.99e0 SMART
WD40 337 376 3.05e-4 SMART
Blast:WD40 423 448 1e-7 BLAST
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family with nine WD repeats. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,816 L110P probably damaging Het
4930522L14Rik A T 5: 109,736,919 C358S probably damaging Het
9330182L06Rik G T 5: 9,440,966 G659* probably null Het
Abca8b C A 11: 109,980,015 V104F possibly damaging Het
Afap1l2 T C 19: 56,917,119 probably benign Het
Ahctf1 A C 1: 179,784,161 I548R probably damaging Het
Alox12b G T 11: 69,169,556 G646V probably damaging Het
Aoah C T 13: 20,911,198 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Atxn1l A G 8: 109,731,693 W646R probably damaging Het
Cabp2 T C 19: 4,084,903 I28T possibly damaging Het
Cacna1b G A 2: 24,687,704 T719I probably damaging Het
Camk1d A T 2: 5,445,135 H70Q probably damaging Het
Car1 T C 3: 14,770,176 T170A probably benign Het
Ccdc162 T C 10: 41,541,860 T2113A probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh17 T A 4: 11,771,273 C18* probably null Het
Cdk17 A T 10: 93,237,790 probably benign Het
Chd9 T A 8: 90,994,450 probably benign Het
Chrm5 T A 2: 112,479,655 K372M possibly damaging Het
Clasp2 A G 9: 113,909,419 T423A probably benign Het
Col11a1 A G 3: 114,205,901 probably benign Het
Col27a1 T C 4: 63,225,611 M512T possibly damaging Het
Dclk3 A G 9: 111,484,935 D693G probably damaging Het
Dcun1d3 T A 7: 119,857,950 K180* probably null Het
Dmxl2 T C 9: 54,416,951 R876G probably benign Het
Dnmbp A T 19: 43,854,857 Y432* probably null Het
Eml2 C T 7: 19,179,531 Q125* probably null Het
Faap100 A C 11: 120,373,876 probably benign Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gda A G 19: 21,417,107 Y129H probably damaging Het
Gga3 G A 11: 115,590,524 R207C probably damaging Het
Glg1 T C 8: 111,182,569 I496M probably damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10322 A T 10: 59,616,208 H49L possibly damaging Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Gramd3 G A 18: 56,474,069 C85Y probably benign Het
Grhl1 C T 12: 24,582,919 P153L probably benign Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hdlbp T C 1: 93,425,332 I414V probably damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Lipe G A 7: 25,398,488 P10L probably benign Het
Lrrc8a A G 2: 30,257,067 E631G probably damaging Het
Lvrn T A 18: 46,905,299 N973K possibly damaging Het
Man2c1 T A 9: 57,135,597 H250Q probably damaging Het
Mup3 T C 4: 62,085,282 T117A probably benign Het
Myo6 A C 9: 80,273,974 probably benign Het
Nbn T A 4: 15,983,951 probably benign Het
Ncapg T A 5: 45,672,428 N157K probably damaging Het
Olfr1024 T A 2: 85,904,157 N299I probably damaging Het
Olfr1137 G A 2: 87,711,430 H159Y probably benign Het
Olfr1154 T C 2: 87,902,960 T239A probably damaging Het
Olfr1178 C T 2: 88,392,033 T262I probably damaging Het
Olfr1434 T A 19: 12,283,903 M285K probably damaging Het
P4ha1 T A 10: 59,348,257 Y180* probably null Het
Pcdhb19 T A 18: 37,499,535 F794L probably benign Het
Pdxdc1 T A 16: 13,854,400 I379F probably damaging Het
Psme3 T A 11: 101,320,442 S185T possibly damaging Het
Ptgr1 A G 4: 58,978,045 S116P probably damaging Het
Ptpn23 A T 9: 110,389,010 probably null Het
Rabgap1l A C 1: 160,722,205 I277R probably benign Het
Rapgef1 C T 2: 29,679,816 T93I possibly damaging Het
Rbp3 A T 14: 33,954,773 D226V probably damaging Het
Rnf144a A T 12: 26,339,329 C38S probably damaging Het
Rptor C T 11: 119,780,553 Q281* probably null Het
Rragd T C 4: 33,004,332 L208S probably damaging Het
Slc12a4 T C 8: 105,959,488 E41G probably damaging Het
Slc16a1 G T 3: 104,653,419 V347F probably benign Het
Slit1 G A 19: 41,743,293 T39I probably damaging Het
Sra1 T C 18: 36,677,503 N98S probably benign Het
Ssx2ip T C 3: 146,426,429 L215P probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Tep1 TTTCTTCTTCTT TTTCTTCTT 14: 50,866,823 probably benign Het
Tgfbi T C 13: 56,632,191 probably benign Het
Tmem232 T C 17: 65,256,503 M632V probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnnt3 T G 7: 142,512,086 D153E probably benign Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Tpsab1 A G 17: 25,343,824 probably benign Het
Usp34 T A 11: 23,401,505 V1431D probably damaging Het
Wdr7 A G 18: 63,796,249 Y1052C probably damaging Het
Zan A T 5: 137,382,316 probably benign Het
Zfp652 G A 11: 95,763,739 V323I possibly damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zfp874b A G 13: 67,481,836 S10P probably damaging Het
Zmynd19 A G 2: 24,958,122 Y110C probably benign Het
Other mutations in Wdr49
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0266:Wdr49 UTSW 3 75451796 missense possibly damaging 0.80
R0599:Wdr49 UTSW 3 75431076 splice site probably null
R0599:Wdr49 UTSW 3 75449890 splice site probably null
R0948:Wdr49 UTSW 3 75450851 missense probably benign 0.06
R1341:Wdr49 UTSW 3 75429333 missense probably damaging 1.00
R1526:Wdr49 UTSW 3 75396920 missense probably benign 0.03
R1593:Wdr49 UTSW 3 75396941 missense probably benign 0.00
R1603:Wdr49 UTSW 3 75396870 nonsense probably null
R1874:Wdr49 UTSW 3 75429347 missense probably damaging 1.00
R2986:Wdr49 UTSW 3 75382040 missense probably benign 0.11
R3013:Wdr49 UTSW 3 75450847 missense probably damaging 0.96
R3025:Wdr49 UTSW 3 75333356 missense possibly damaging 0.94
R4027:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4029:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4030:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4031:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4578:Wdr49 UTSW 3 75335243 missense probably benign 0.00
R6024:Wdr49 UTSW 3 75301826 missense probably benign 0.02
R6141:Wdr49 UTSW 3 75323682 missense probably benign
R6172:Wdr49 UTSW 3 75298180 missense probably damaging 1.00
R6263:Wdr49 UTSW 3 75481517 missense possibly damaging 0.84
R6501:Wdr49 UTSW 3 75339458 missense probably benign 0.01
R6584:Wdr49 UTSW 3 75337758 missense probably benign 0.01
R6698:Wdr49 UTSW 3 75429366 missense probably benign 0.01
R6891:Wdr49 UTSW 3 75333283 synonymous probably null
R7202:Wdr49 UTSW 3 75333273 missense probably benign 0.11
R7214:Wdr49 UTSW 3 75358444 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACTATTCAAACCCAGTACCTTGCCG -3'
(R):5'- GCCAGACACTGAAGAGGCTTGAAC -3'

Sequencing Primer
(F):5'- GGACCCAGTCTCCATGATGAAG -3'
(R):5'- AGTTGGAAACCACTCTGTGC -3'
Posted On2013-05-23