Incidental Mutation 'R5099:Tmem176b'
ID388173
Institutional Source Beutler Lab
Gene Symbol Tmem176b
Ensembl Gene ENSMUSG00000029810
Gene Nametransmembrane protein 176B
Synonyms1810009M01Rik, Clast1, Lr8
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5099 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48833818-48841496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48834529 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 62 (Y62C)
Ref Sequence ENSEMBL: ENSMUSP00000144810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101429] [ENSMUST00000164733] [ENSMUST00000166247] [ENSMUST00000203229] [ENSMUST00000203265] [ENSMUST00000203355] [ENSMUST00000203501] [ENSMUST00000204073] [ENSMUST00000204783] [ENSMUST00000205147] [ENSMUST00000205159]
Predicted Effect probably benign
Transcript: ENSMUST00000101429
AA Change: Y228C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098972
Gene: ENSMUSG00000029810
AA Change: Y228C

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164733
AA Change: Y228C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128705
Gene: ENSMUSG00000029810
AA Change: Y228C

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166247
AA Change: Y228C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131064
Gene: ENSMUSG00000029810
AA Change: Y228C

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203229
SMART Domains Protein: ENSMUSP00000144865
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203265
SMART Domains Protein: ENSMUSP00000144869
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 194 2.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203355
AA Change: Y228C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145395
Gene: ENSMUSG00000029810
AA Change: Y228C

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203501
SMART Domains Protein: ENSMUSP00000144742
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 170 3.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203618
Predicted Effect probably benign
Transcript: ENSMUST00000204073
AA Change: Y228C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144864
Gene: ENSMUSG00000029810
AA Change: Y228C

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204783
AA Change: Y62C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144810
Gene: ENSMUSG00000029810
AA Change: Y62C

DomainStartEndE-ValueType
Pfam:CD20 1 58 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205147
SMART Domains Protein: ENSMUSP00000145235
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205159
SMART Domains Protein: ENSMUSP00000144949
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 196 1.2e-35 PFAM
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit severe sporadic ataxia and a small cerebellum associated with abnormal cerebellar lobulation, loss of the internal granule cell layer, poor formation of the external germinal layer, and disorganized Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Arsa A G 15: 89,475,339 L80P probably damaging Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsr T A 8: 33,671,528 I121N probably damaging Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Jakmip2 A G 18: 43,568,108 I414T probably benign Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Mff C T 1: 82,750,471 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr206 C T 16: 59,344,903 G266D probably benign Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Prr22 T C 17: 56,771,467 F207L probably benign Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Sp2 T C 11: 96,961,349 K250E probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Vmn1r81 A G 7: 12,260,321 I120T possibly damaging Het
Other mutations in Tmem176b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Tmem176b APN 6 48834070 missense possibly damaging 0.79
IGL02374:Tmem176b APN 6 48834626 missense possibly damaging 0.60
IGL03027:Tmem176b APN 6 48835639 missense probably damaging 1.00
IGL03134:Tmem176b UTSW 6 48838353 missense probably benign 0.00
R1634:Tmem176b UTSW 6 48834566 missense probably damaging 1.00
R1920:Tmem176b UTSW 6 48838204 missense possibly damaging 0.70
R2008:Tmem176b UTSW 6 48835449 missense probably damaging 0.97
R2056:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R2057:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R2059:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R5484:Tmem176b UTSW 6 48834533 missense probably benign 0.01
R5623:Tmem176b UTSW 6 48834070 missense probably benign 0.14
R6102:Tmem176b UTSW 6 48835934 missense probably benign 0.30
R6413:Tmem176b UTSW 6 48838332 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTCCGCACTTGAAAGCAGC -3'
(R):5'- AGAGGATGCCACCTGCTTTC -3'

Sequencing Primer
(F):5'- TGACAGCAAGGAGGAGCTCTC -3'
(R):5'- CTTTCCTGGAAAGTGTCTGGAC -3'
Posted On2016-06-06