Incidental Mutation 'R5064:Plppr1'
ID388251
Institutional Source Beutler Lab
Gene Symbol Plppr1
Ensembl Gene ENSMUSG00000063446
Gene Namephospholipid phosphatase related 1
SynonymsPRG-3, E130309F12Rik, Lppr1
MMRRC Submission 042654-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5064 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49059273-49340259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49319974 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 200 (H200L)
Ref Sequence ENSEMBL: ENSMUSP00000075966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076670]
Predicted Effect probably benign
Transcript: ENSMUST00000076670
AA Change: H200L

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075966
Gene: ENSMUSG00000063446
AA Change: H200L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 128 272 4.47e-16 SMART
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plasticity-related gene (PRG) family. Members of the PRG family mediate lipid phosphate phosphatase activity in neurons and are known to be involved in neuronal plasticity. The protein encoded by this gene does not perform its function through enzymatic phospholipid degradation. This gene is strongly expressed in brain. It shows dynamic expression regulation during brain development and neuronal excitation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,535,655 noncoding transcript Het
Abca12 A G 1: 71,300,960 V1082A probably damaging Het
Adamts7 T A 9: 90,195,830 Y1496N probably damaging Het
Ascl2 T C 7: 142,968,259 N151D possibly damaging Het
Asxl3 G T 18: 22,516,019 S355I probably benign Het
Cttnbp2 T C 6: 18,448,279 Q127R probably damaging Het
Efhc1 T A 1: 20,974,963 I401N possibly damaging Het
Eml6 C T 11: 29,749,300 V1818I probably benign Het
Fam129a A G 1: 151,689,659 I247V probably benign Het
Grin1 G T 2: 25,303,831 probably benign Het
Ints2 C T 11: 86,249,274 R244H probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mllt6 C A 11: 97,673,949 A527E probably damaging Het
Msh5 G T 17: 35,043,783 probably benign Het
Mypn T A 10: 63,123,371 D1057V possibly damaging Het
Nasp A G 4: 116,611,970 probably null Het
Nat8l T C 5: 33,996,869 V9A probably damaging Het
Nr1h2 G A 7: 44,551,649 A219V possibly damaging Het
Nup155 C A 15: 8,135,870 H663Q probably damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Por T C 5: 135,733,795 V421A probably benign Het
Pxylp1 T G 9: 96,854,800 probably benign Het
Serpina3a G A 12: 104,116,189 V74I probably benign Het
Sfxn1 T C 13: 54,085,569 I37T probably benign Het
Thsd7a G T 6: 12,330,952 T1397N possibly damaging Het
Tnrc6a T C 7: 123,186,723 probably null Het
Vmn1r55 A T 7: 5,146,929 M165K probably benign Het
Vmn2r58 A T 7: 41,837,110 M787K probably damaging Het
Vta1 G T 10: 14,705,478 probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Other mutations in Plppr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Plppr1 APN 4 49319992 missense possibly damaging 0.88
PIT4403001:Plppr1 UTSW 4 49337648 missense probably benign 0.01
R0605:Plppr1 UTSW 4 49323466 missense probably damaging 1.00
R1381:Plppr1 UTSW 4 49337674 missense possibly damaging 0.85
R1452:Plppr1 UTSW 4 49301067 splice site probably benign
R1682:Plppr1 UTSW 4 49325617 critical splice acceptor site probably null
R1980:Plppr1 UTSW 4 49337655 missense probably benign 0.09
R4261:Plppr1 UTSW 4 49300993 missense probably benign 0.09
R4674:Plppr1 UTSW 4 49323384 missense probably damaging 1.00
R5144:Plppr1 UTSW 4 49319800 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTTGTAAACGCGGGGCAAG -3'
(R):5'- GGCTTATCAACAGTGTGATATGATG -3'

Sequencing Primer
(F):5'- AGTCGTCACTGGTCACCTAAC -3'
(R):5'- CCTCTGATACATATGCAGCTGGAG -3'
Posted On2016-06-06