Incidental Mutation 'R5066:Sybu'
ID388345
Institutional Source Beutler Lab
Gene Symbol Sybu
Ensembl Gene ENSMUSG00000022340
Gene Namesyntabulin (syntaxin-interacting)
SynonymsA830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
MMRRC Submission 042656-MU
Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5066 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location44671856-44788063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44677644 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 341 (C341R)
Ref Sequence ENSEMBL: ENSMUSP00000087511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]
Predicted Effect probably damaging
Transcript: ENSMUST00000090057
AA Change: C341R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: C341R

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
low complexity region 174 205 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Pfam:Syntaphilin 343 638 3.5e-142 PFAM
low complexity region 738 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110267
AA Change: C213R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: C213R

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 46 77 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Pfam:Syntaphilin 214 511 5.8e-140 PFAM
low complexity region 610 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110269
AA Change: C141R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: C141R

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
Pfam:Syntaphilin 142 439 4.4e-140 PFAM
low complexity region 538 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227081
Predicted Effect probably damaging
Transcript: ENSMUST00000227305
AA Change: C212R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000228057
AA Change: C213R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A T 11: 70,616,591 Y154F probably benign Het
Abca5 A T 11: 110,309,350 probably benign Het
Agtpbp1 T A 13: 59,474,550 D11V probably damaging Het
Aldh1a2 G A 9: 71,281,700 A299T possibly damaging Het
Apc T A 18: 34,316,105 V1984D probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Atp13a2 G A 4: 141,005,138 V905M probably damaging Het
Atp1a1 C T 3: 101,582,104 G731R probably damaging Het
Atrn T C 2: 130,994,193 V1131A possibly damaging Het
BC049762 A G 11: 51,254,424 F112S probably damaging Het
Bcl2l13 T A 6: 120,887,021 V312E possibly damaging Het
Chic2 A G 5: 75,027,156 V81A possibly damaging Het
Drg1 A T 11: 3,259,353 I122N possibly damaging Het
Flt4 A G 11: 49,634,163 N612S possibly damaging Het
Gm11639 A G 11: 104,720,664 D444G probably benign Het
Hadhb T C 5: 30,164,096 probably benign Het
Heg1 G T 16: 33,738,671 R856S probably benign Het
Ice2 A C 9: 69,408,291 N143T probably benign Het
Igkv8-21 G A 6: 70,315,443 Q4* probably null Het
Lrfn2 T C 17: 49,096,420 S524P probably damaging Het
Mndal C A 1: 173,875,663 A59S probably damaging Het
Mpp7 T C 18: 7,513,002 E33G possibly damaging Het
Nedd4 T A 9: 72,710,519 D187E probably damaging Het
Nfx1 A G 4: 40,991,868 I519V probably benign Het
Olfr773 T C 10: 129,186,564 I286V possibly damaging Het
Olfr9 G A 10: 128,990,791 R293Q probably damaging Het
Padi1 T C 4: 140,829,437 N153S probably damaging Het
Parp10 A G 15: 76,240,946 probably benign Het
Ppil2 A G 16: 17,109,675 Y18H probably benign Het
Setbp1 A T 18: 78,857,299 M1051K probably damaging Het
Slc2a7 T A 4: 150,160,116 M347K probably damaging Het
Slc45a2 C A 15: 11,012,607 T232K probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Spata13 T C 14: 60,750,089 Y899H possibly damaging Het
Sult1c1 T A 17: 53,973,998 I26F probably damaging Het
Syk T A 13: 52,641,982 S538T possibly damaging Het
Syne2 A G 12: 75,966,551 T2840A probably benign Het
Thsd4 A G 9: 59,976,332 C924R probably damaging Het
Tle1 A G 4: 72,158,267 S175P probably benign Het
Tmbim4 C T 10: 120,217,632 T112M probably benign Het
Tmprss11a A G 5: 86,420,000 probably null Het
Tnc C A 4: 63,975,229 D1698Y probably damaging Het
Other mutations in Sybu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Sybu APN 15 44672805 missense probably damaging 1.00
IGL02211:Sybu APN 15 44673466 missense probably damaging 1.00
IGL02303:Sybu APN 15 44673223 missense probably benign 0.03
E7848:Sybu UTSW 15 44673422 missense probably benign 0.32
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0413:Sybu UTSW 15 44673272 missense probably damaging 1.00
R0650:Sybu UTSW 15 44673268 missense probably benign 0.08
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1307:Sybu UTSW 15 44675390 missense probably damaging 1.00
R1568:Sybu UTSW 15 44718832 nonsense probably null
R2112:Sybu UTSW 15 44673335 missense probably benign 0.06
R2967:Sybu UTSW 15 44746356 missense probably damaging 1.00
R3120:Sybu UTSW 15 44672959 missense possibly damaging 0.88
R3429:Sybu UTSW 15 44746458 missense probably damaging 0.98
R3508:Sybu UTSW 15 44673082 missense probably damaging 1.00
R3720:Sybu UTSW 15 44672632 missense possibly damaging 0.89
R4080:Sybu UTSW 15 44718943 missense probably damaging 1.00
R4898:Sybu UTSW 15 44675499 missense probably benign 0.02
R4975:Sybu UTSW 15 44677667 missense probably damaging 1.00
R5783:Sybu UTSW 15 44746414 missense probably damaging 0.96
R5913:Sybu UTSW 15 44787621 missense probably damaging 1.00
R6977:Sybu UTSW 15 44677695 missense probably benign 0.00
R7044:Sybu UTSW 15 44677695 missense possibly damaging 0.79
R7139:Sybu UTSW 15 44677714 missense possibly damaging 0.93
R7328:Sybu UTSW 15 44787794 missense not run
Predicted Primers PCR Primer
(F):5'- TTCCCACCTTTAGAGAAAAGTCCC -3'
(R):5'- GCCCCAGTCAACTCTAGAAGTC -3'

Sequencing Primer
(F):5'- CTTTAGAGAAAAGTCCCAAACTGG -3'
(R):5'- CTTAGCAATAACCAGCTTTAGGAAGG -3'
Posted On2016-06-06