Incidental Mutation 'R5068:Pias3'
ID388417
Institutional Source Beutler Lab
Gene Symbol Pias3
Ensembl Gene ENSMUSG00000028101
Gene Nameprotein inhibitor of activated STAT 3
SynonymsPias3L
MMRRC Submission 042658-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R5068 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96696384-96706070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96703855 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 431 (K431E)
Ref Sequence ENSEMBL: ENSMUSP00000102692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029742] [ENSMUST00000064900] [ENSMUST00000107076] [ENSMUST00000107077] [ENSMUST00000162778] [ENSMUST00000162934] [ENSMUST00000171249] [ENSMUST00000176302] [ENSMUST00000200387]
Predicted Effect probably benign
Transcript: ENSMUST00000029742
SMART Domains Protein: ENSMUSP00000029742
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:NUDIX 92 252 2.2e-9 PFAM
low complexity region 273 288 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064900
AA Change: K466E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069259
Gene: ENSMUSG00000028101
AA Change: K466E

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
low complexity region 70 109 N/A INTRINSIC
Pfam:PINIT 126 278 1.1e-38 PFAM
Pfam:zf-MIZ 323 372 1.7e-22 PFAM
low complexity region 608 617 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107076
AA Change: K457E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102691
Gene: ENSMUSG00000028101
AA Change: K457E

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.1e-45 PFAM
Pfam:zf-Nse 305 361 8e-7 PFAM
Pfam:zf-MIZ 314 363 2.2e-21 PFAM
low complexity region 599 608 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107077
AA Change: K431E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102692
Gene: ENSMUSG00000028101
AA Change: K431E

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
Pfam:PINIT 87 243 5.3e-46 PFAM
Pfam:zf-Nse 279 335 2.4e-7 PFAM
Pfam:zf-MIZ 288 337 7.4e-22 PFAM
low complexity region 573 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161296
Predicted Effect probably benign
Transcript: ENSMUST00000162156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162707
Predicted Effect probably benign
Transcript: ENSMUST00000162778
SMART Domains Protein: ENSMUSP00000125377
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162934
SMART Domains Protein: ENSMUSP00000125747
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.3e-46 PFAM
Pfam:zf-Nse 305 361 7e-8 PFAM
Pfam:zf-MIZ 314 363 2.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171249
SMART Domains Protein: ENSMUSP00000129851
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:NUDIX 92 235 1.2e-18 PFAM
low complexity region 256 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176288
Predicted Effect probably benign
Transcript: ENSMUST00000176302
SMART Domains Protein: ENSMUSP00000134835
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 2.57e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196773
Predicted Effect probably benign
Transcript: ENSMUST00000200387
SMART Domains Protein: ENSMUSP00000142879
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:NUDIX 79 125 4.2e-6 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Double KO mice display a retinal phenotype reduced M-cone response at P21 and reduced S-cone and rod responses from 7 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,436 Y155D probably benign Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
6030468B19Rik A G 11: 117,802,875 Y56C possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Add2 T A 6: 86,107,458 L496Q probably damaging Het
Akt1s1 T C 7: 44,850,008 probably null Het
Als2 G T 1: 59,211,274 P437Q probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd17 T C 5: 90,254,808 R1464G probably damaging Het
Ankrd24 T C 10: 81,639,865 S121P possibly damaging Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Bnip3l T C 14: 66,999,632 E57G possibly damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cc2d1b T C 4: 108,623,464 V27A possibly damaging Het
Cdc37 T C 9: 21,149,803 T19A probably damaging Het
Cep152 T C 2: 125,571,816 I1199V probably benign Het
Chd6 G T 2: 160,966,369 L1642I possibly damaging Het
Chst13 T C 6: 90,309,569 E137G possibly damaging Het
Cnrip1 A G 11: 17,054,687 D79G probably damaging Het
Dars2 A T 1: 161,041,913 C589S probably benign Het
Dhx15 T G 5: 52,170,067 I102L possibly damaging Het
Dip2a A G 10: 76,318,043 L151P possibly damaging Het
Dlc1 T C 8: 36,938,030 T202A probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dlgap4 T C 2: 156,707,111 F464L probably benign Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Dthd1 C A 5: 62,818,716 D244E probably benign Het
Dtl A T 1: 191,568,373 D126E probably damaging Het
Ell2 A G 13: 75,763,618 N341S probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Erbb4 A T 1: 68,043,902 probably null Het
Erc2 A T 14: 28,302,943 H593L possibly damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fyn A G 10: 39,526,843 K204E probably damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gm4847 A T 1: 166,638,384 F212Y possibly damaging Het
Gpc5 T C 14: 115,417,264 *499R probably null Het
Hcn4 T C 9: 58,860,021 L955P unknown Het
Hook2 C A 8: 84,993,399 L111I possibly damaging Het
Hook3 C T 8: 26,095,757 probably null Het
Hvcn1 T C 5: 122,233,481 F28S probably damaging Het
Igkv6-32 A G 6: 70,074,283 F30L possibly damaging Het
Inpp5b G A 4: 124,742,649 probably null Het
Itgb2 G A 10: 77,548,761 A239T probably damaging Het
Kcnrg T C 14: 61,607,817 L102P probably damaging Het
Kif16b A T 2: 142,711,707 M1068K probably benign Het
Kifc3 T C 8: 95,110,216 R109G possibly damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Kptn T C 7: 16,123,102 Y172H probably damaging Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrc1 T A 2: 14,306,516 M868K probably benign Het
Mterf1a T C 5: 3,891,854 N5D probably benign Het
Muc5b T C 7: 141,858,608 S1764P unknown Het
Myo9b T C 8: 71,349,055 Y1275H probably damaging Het
Nek1 T C 8: 61,016,296 I129T probably damaging Het
Net1 G A 13: 3,886,740 A221V probably benign Het
Nuak2 A T 1: 132,331,771 D429V probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr648 T A 7: 104,180,241 S56C probably damaging Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Olfr901 T C 9: 38,430,464 Y61H probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh7 T C 5: 57,722,166 V1021A probably damaging Het
Pclo G C 5: 14,679,073 probably benign Het
Pds5a A C 5: 65,615,272 D1329E probably damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Piwil1 T C 5: 128,741,614 S158P probably damaging Het
Plxnc1 A T 10: 94,799,377 I1329N possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pnpla1 T A 17: 28,879,423 probably null Het
Prdm10 T C 9: 31,359,047 Y827H probably damaging Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rgl3 A G 9: 21,988,044 probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rpp40 T C 13: 35,898,698 N254D probably benign Het
Scin T A 12: 40,124,700 H128L probably damaging Het
Sh3bp2 A T 5: 34,556,967 M225L probably benign Het
Shisa9 C A 16: 12,267,548 H324Q possibly damaging Het
Sipa1l1 A G 12: 82,437,827 D1585G probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slc6a13 T C 6: 121,333,342 L320P probably damaging Het
Spats2l A G 1: 57,943,221 T421A probably benign Het
Spryd3 A T 15: 102,128,611 D207E probably benign Het
Srrt T C 5: 137,296,541 N392S possibly damaging Het
Stk36 G T 1: 74,622,345 R510S probably benign Het
Sucnr1 A G 3: 60,086,867 Y272C probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uap1 G T 1: 170,161,463 P130Q probably damaging Het
Ube3c T C 5: 29,601,354 probably null Het
Umad1 A T 6: 8,401,157 probably null Het
Usp34 T C 11: 23,460,665 V2705A possibly damaging Het
Vps13a T C 19: 16,746,058 S259G probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdfy3 T C 5: 101,894,937 T1983A probably benign Het
Wdr24 T G 17: 25,825,779 F203V possibly damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp282 A C 6: 47,877,703 Q11P probably benign Het
Zfp750 T A 11: 121,512,195 T576S probably benign Het
Other mutations in Pias3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Pias3 APN 3 96699422 splice site probably benign
IGL01370:Pias3 APN 3 96703575 missense probably damaging 0.96
IGL01806:Pias3 APN 3 96703757 missense probably benign 0.02
IGL02533:Pias3 APN 3 96699616 missense possibly damaging 0.71
IGL02998:Pias3 APN 3 96702179 missense probably damaging 0.98
IGL03304:Pias3 APN 3 96700031 missense possibly damaging 0.65
R0764:Pias3 UTSW 3 96701295 missense probably damaging 1.00
R1611:Pias3 UTSW 3 96699697 unclassified probably null
R1697:Pias3 UTSW 3 96702225 missense probably damaging 1.00
R1751:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R1767:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R2184:Pias3 UTSW 3 96702221 missense possibly damaging 0.92
R2257:Pias3 UTSW 3 96699646 missense probably benign 0.22
R2398:Pias3 UTSW 3 96703813 missense probably benign 0.00
R2851:Pias3 UTSW 3 96703537 missense possibly damaging 0.94
R3845:Pias3 UTSW 3 96702210 missense probably benign 0.28
R4127:Pias3 UTSW 3 96699666 missense probably damaging 0.97
R4500:Pias3 UTSW 3 96701418 missense probably damaging 1.00
R4628:Pias3 UTSW 3 96699820 missense probably damaging 1.00
R5108:Pias3 UTSW 3 96704937 missense possibly damaging 0.88
R5477:Pias3 UTSW 3 96705003 missense probably damaging 0.99
R5498:Pias3 UTSW 3 96702188 missense possibly damaging 0.89
R6457:Pias3 UTSW 3 96699523 missense possibly damaging 0.81
R6966:Pias3 UTSW 3 96702195 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAGCTAAGTCATGGCTGGC -3'
(R):5'- ACTCATGTAGCGGGAGACTAG -3'

Sequencing Primer
(F):5'- GGCCCTTTCTCTGAGACAG -3'
(R):5'- GACAGGAAGTCACTGCCCAG -3'
Posted On2016-06-06