Incidental Mutation 'R5070:Cds2'
ID388618
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
MMRRC Submission 042660-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5070 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 132302088 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 4 (Y4*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181] [ENSMUST00000147456]
Predicted Effect probably null
Transcript: ENSMUST00000089461
AA Change: Y261*
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793
AA Change: Y261*

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103181
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793
AA Change: Y278*

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138194
AA Change: Y4*
SMART Domains Protein: ENSMUSP00000121769
Gene: ENSMUSG00000058793
AA Change: Y4*

DomainStartEndE-ValueType
Pfam:CTP_transf_1 3 126 8.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147456
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik G T 15: 84,420,163 A14E possibly damaging Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
Acacb T C 5: 114,246,028 I2206T possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
AI987944 C T 7: 41,375,324 G77D probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
Bend3 A T 10: 43,493,685 E11D probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Celsr1 G T 15: 85,939,134 P1691Q possibly damaging Het
Chmp1a A T 8: 123,206,315 V133E probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Comp G A 8: 70,376,495 G272S probably benign Het
Csnk1a1 T A 18: 61,555,781 F11I probably benign Het
Ctse A G 1: 131,668,179 D203G probably damaging Het
Cyp1b1 T A 17: 79,710,611 M372L probably benign Het
Cyp2c66 T A 19: 39,163,470 S210T probably benign Het
Dnah1 G A 14: 31,282,418 P2385S probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Eif4g3 A G 4: 138,146,299 T682A probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fam136b-ps C T 15: 31,276,716 probably benign Het
Fbxl7 T A 15: 26,789,554 H29L probably benign Het
Fbxw22 A G 9: 109,385,115 V211A probably benign Het
Frk A T 10: 34,484,284 K94* probably null Het
G0s2 T A 1: 193,272,562 E71D probably damaging Het
Gfpt1 A G 6: 87,053,745 probably null Het
Gga1 A G 15: 78,892,017 D420G possibly damaging Het
Gldc T C 19: 30,118,598 Q671R possibly damaging Het
Gpc6 A G 14: 117,186,769 T90A probably benign Het
Gucy2g C A 19: 55,229,787 V410F probably damaging Het
Ifnlr1 T C 4: 135,704,198 S233P probably benign Het
Ighv1-9 A T 12: 114,583,757 W55R probably damaging Het
Igsf10 T A 3: 59,328,293 H1489L probably benign Het
Il17re T C 6: 113,459,010 L39P probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Kcnk3 A G 5: 30,622,386 H260R possibly damaging Het
Kctd19 T C 8: 105,391,999 Y287C probably damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Lama2 A G 10: 27,350,251 probably null Het
Lrrc27 A T 7: 139,214,799 D26V probably damaging Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Mei1 T A 15: 82,077,603 C188S possibly damaging Het
Mettl13 C T 1: 162,545,899 R261H possibly damaging Het
Mex3a A T 3: 88,536,387 I257F probably damaging Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mier2 T C 10: 79,549,577 D139G probably benign Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrvi1 A G 7: 110,925,312 S208P probably benign Het
Myh14 A G 7: 44,616,248 V1569A possibly damaging Het
Myo18b T C 5: 112,761,346 E1977G probably damaging Het
Myo3b T C 2: 70,253,112 L675P probably damaging Het
N4bp1 A G 8: 86,860,537 V591A probably damaging Het
Nedd9 C A 13: 41,316,598 V360L probably benign Het
Oit3 C T 10: 59,424,027 R518H probably damaging Het
Olfr1122 T G 2: 87,388,163 C153G probably damaging Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr171 A G 16: 19,624,992 I36T possibly damaging Het
Olfr342 T A 2: 36,527,766 M118K probably damaging Het
Olfr531 A G 7: 140,400,569 V159A probably benign Het
Olfr744 A G 14: 50,618,474 N84S probably benign Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pask A T 1: 93,330,874 C251S probably damaging Het
Pdzk1 A T 3: 96,850,321 D31V probably benign Het
Pmfbp1 A T 8: 109,530,155 Q497L probably damaging Het
Pofut1 T C 2: 153,261,566 probably benign Het
Polr2h A G 16: 20,721,966 N95S probably damaging Het
Pou2f3 A G 9: 43,145,281 V93A possibly damaging Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Prkd1 A T 12: 50,394,622 L327* probably null Het
Prrt4 T C 6: 29,177,512 E86G probably benign Het
Psen2 T C 1: 180,228,857 I393V probably benign Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Qser1 C T 2: 104,787,282 V1062I possibly damaging Het
Rab11b G T 17: 33,748,881 A114D probably damaging Het
Rag1 A T 2: 101,642,311 W829R probably damaging Het
Rgl3 A G 9: 21,988,044 probably null Het
Rgs8 C T 1: 153,665,904 T3I probably damaging Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rps6kb2 A T 19: 4,163,228 D6E probably damaging Het
Skint5 T A 4: 113,795,538 I630F unknown Het
Skint7 T C 4: 111,984,134 L257P probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Sorl1 T C 9: 42,031,818 K921E possibly damaging Het
Stub1 A G 17: 25,832,138 L90P probably damaging Het
Sycp1 A T 3: 102,920,565 S289T probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tead3 T C 17: 28,341,477 K51R probably benign Het
Tmed11 T A 5: 108,795,223 I30L probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tmem191c A G 16: 17,277,695 Q206R probably null Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uqcrq A G 11: 53,430,127 probably null Het
Vmn1r215 T A 13: 23,076,496 S235R probably benign Het
Vmn1r70 T C 7: 10,634,398 V271A probably benign Het
Vps13a G A 19: 16,654,484 R2596C probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdr90 T C 17: 25,846,333 T1650A probably damaging Het
Zbtb32 T A 7: 30,591,466 M135L probably benign Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp30 A G 7: 29,786,266 probably benign Het
Zfp428 T A 7: 24,515,125 D55E probably damaging Het
Zfyve26 A T 12: 79,255,361 N1820K probably damaging Het
Zw10 C A 9: 49,077,459 S675* probably null Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0593:Cds2 UTSW 2 132297376 unclassified probably benign
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1053:Cds2 UTSW 2 132305260 missense probably damaging 1.00
R1669:Cds2 UTSW 2 132295519 splice site probably null
R1740:Cds2 UTSW 2 132302213 missense possibly damaging 0.63
R1859:Cds2 UTSW 2 132302195 missense probably damaging 1.00
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4467:Cds2 UTSW 2 132294446 nonsense probably null
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5704:Cds2 UTSW 2 132293329 missense probably benign 0.01
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCTGGGCTTTTCAAGGTC -3'
(R):5'- GCCGTCACTCATGTAAAGGG -3'

Sequencing Primer
(F):5'- GATCTTGCTTAACAGTTAGGTGAAC -3'
(R):5'- CGTCACTCATGTAAAGGGTACGC -3'
Posted On2016-06-06