Incidental Mutation 'R5070:Sorl1'
ID388657
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 042660-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R5070 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42031818 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 921 (K921E)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060989
AA Change: K921E

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: K921E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143710
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik G T 15: 84,420,163 A14E possibly damaging Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
Acacb T C 5: 114,246,028 I2206T possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
AI987944 C T 7: 41,375,324 G77D probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
Bend3 A T 10: 43,493,685 E11D probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Cds2 T A 2: 132,302,088 Y4* probably null Het
Celsr1 G T 15: 85,939,134 P1691Q possibly damaging Het
Chmp1a A T 8: 123,206,315 V133E probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Comp G A 8: 70,376,495 G272S probably benign Het
Csnk1a1 T A 18: 61,555,781 F11I probably benign Het
Ctse A G 1: 131,668,179 D203G probably damaging Het
Cyp1b1 T A 17: 79,710,611 M372L probably benign Het
Cyp2c66 T A 19: 39,163,470 S210T probably benign Het
Dnah1 G A 14: 31,282,418 P2385S probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Eif4g3 A G 4: 138,146,299 T682A probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fam136b-ps C T 15: 31,276,716 probably benign Het
Fbxl7 T A 15: 26,789,554 H29L probably benign Het
Fbxw22 A G 9: 109,385,115 V211A probably benign Het
Frk A T 10: 34,484,284 K94* probably null Het
G0s2 T A 1: 193,272,562 E71D probably damaging Het
Gfpt1 A G 6: 87,053,745 probably null Het
Gga1 A G 15: 78,892,017 D420G possibly damaging Het
Gldc T C 19: 30,118,598 Q671R possibly damaging Het
Gpc6 A G 14: 117,186,769 T90A probably benign Het
Gucy2g C A 19: 55,229,787 V410F probably damaging Het
Ifnlr1 T C 4: 135,704,198 S233P probably benign Het
Ighv1-9 A T 12: 114,583,757 W55R probably damaging Het
Igsf10 T A 3: 59,328,293 H1489L probably benign Het
Il17re T C 6: 113,459,010 L39P probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Kcnk3 A G 5: 30,622,386 H260R possibly damaging Het
Kctd19 T C 8: 105,391,999 Y287C probably damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Lama2 A G 10: 27,350,251 probably null Het
Lrrc27 A T 7: 139,214,799 D26V probably damaging Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Mei1 T A 15: 82,077,603 C188S possibly damaging Het
Mettl13 C T 1: 162,545,899 R261H possibly damaging Het
Mex3a A T 3: 88,536,387 I257F probably damaging Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mier2 T C 10: 79,549,577 D139G probably benign Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrvi1 A G 7: 110,925,312 S208P probably benign Het
Myh14 A G 7: 44,616,248 V1569A possibly damaging Het
Myo18b T C 5: 112,761,346 E1977G probably damaging Het
Myo3b T C 2: 70,253,112 L675P probably damaging Het
N4bp1 A G 8: 86,860,537 V591A probably damaging Het
Nedd9 C A 13: 41,316,598 V360L probably benign Het
Oit3 C T 10: 59,424,027 R518H probably damaging Het
Olfr1122 T G 2: 87,388,163 C153G probably damaging Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr171 A G 16: 19,624,992 I36T possibly damaging Het
Olfr342 T A 2: 36,527,766 M118K probably damaging Het
Olfr531 A G 7: 140,400,569 V159A probably benign Het
Olfr744 A G 14: 50,618,474 N84S probably benign Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pask A T 1: 93,330,874 C251S probably damaging Het
Pdzk1 A T 3: 96,850,321 D31V probably benign Het
Pmfbp1 A T 8: 109,530,155 Q497L probably damaging Het
Pofut1 T C 2: 153,261,566 probably benign Het
Polr2h A G 16: 20,721,966 N95S probably damaging Het
Pou2f3 A G 9: 43,145,281 V93A possibly damaging Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Prkd1 A T 12: 50,394,622 L327* probably null Het
Prrt4 T C 6: 29,177,512 E86G probably benign Het
Psen2 T C 1: 180,228,857 I393V probably benign Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Qser1 C T 2: 104,787,282 V1062I possibly damaging Het
Rab11b G T 17: 33,748,881 A114D probably damaging Het
Rag1 A T 2: 101,642,311 W829R probably damaging Het
Rgl3 A G 9: 21,988,044 probably null Het
Rgs8 C T 1: 153,665,904 T3I probably damaging Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rps6kb2 A T 19: 4,163,228 D6E probably damaging Het
Skint5 T A 4: 113,795,538 I630F unknown Het
Skint7 T C 4: 111,984,134 L257P probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Stub1 A G 17: 25,832,138 L90P probably damaging Het
Sycp1 A T 3: 102,920,565 S289T probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tead3 T C 17: 28,341,477 K51R probably benign Het
Tmed11 T A 5: 108,795,223 I30L probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tmem191c A G 16: 17,277,695 Q206R probably null Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uqcrq A G 11: 53,430,127 probably null Het
Vmn1r215 T A 13: 23,076,496 S235R probably benign Het
Vmn1r70 T C 7: 10,634,398 V271A probably benign Het
Vps13a G A 19: 16,654,484 R2596C probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdr90 T C 17: 25,846,333 T1650A probably damaging Het
Zbtb32 T A 7: 30,591,466 M135L probably benign Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp30 A G 7: 29,786,266 probably benign Het
Zfp428 T A 7: 24,515,125 D55E probably damaging Het
Zfyve26 A T 12: 79,255,361 N1820K probably damaging Het
Zw10 C A 9: 49,077,459 S675* probably null Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense not run
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCAGATTTGAAGGCACGG -3'
(R):5'- ACCTCTGAGACGTAGAATCAAG -3'

Sequencing Primer
(F):5'- AAGGCACGGCGTTTTTAAGGC -3'
(R):5'- CGTAGAATCAAGGCTGGCC -3'
Posted On2016-06-06