Incidental Mutation 'R5071:Hydin'
ID388788
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
MMRRC Submission 042661-MU
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R5071 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110538473 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 2763 (N2763D)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
Predicted Effect probably benign
Transcript: ENSMUST00000043141
AA Change: N2763D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: N2763D

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI182371 A T 2: 35,085,215 I334N probably benign Het
Aldh1b1 A G 4: 45,803,383 probably null Het
Armc9 G A 1: 86,186,116 M298I probably benign Het
Atp8a1 T A 5: 67,815,723 K27N probably benign Het
BC004004 G A 17: 29,294,415 probably null Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh17 G T 4: 11,810,325 G672V probably damaging Het
Cdh5 C A 8: 104,140,702 T537K probably damaging Het
Chd1 T A 17: 15,762,405 S1377R probably benign Het
Chd2 T C 7: 73,429,689 N1821S probably benign Het
Cnot3 A G 7: 3,650,861 K4R probably damaging Het
Colq T A 14: 31,528,832 I339F possibly damaging Het
Coq2 A T 5: 100,667,950 L121Q probably damaging Het
Csnk1e G A 15: 79,420,872 R342* probably null Het
Cstl1 A T 2: 148,750,927 M1L probably benign Het
Cwh43 A G 5: 73,423,913 probably null Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dgkh T C 14: 78,604,532 K417E probably damaging Het
Dnah11 A T 12: 118,082,453 L1750* probably null Het
Edn1 A G 13: 42,303,677 E62G probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Fitm1 T A 14: 55,575,773 V31E possibly damaging Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gabrd A C 4: 155,387,162 F228C probably damaging Het
Gm5916 A C 9: 36,128,668 L8R probably benign Het
Gm9573 G A 17: 35,620,552 probably benign Het
Gpr108 A G 17: 57,235,335 S557P probably damaging Het
Gpr75 C A 11: 30,892,380 N428K probably damaging Het
H2-M5 T G 17: 36,987,184 probably null Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Homer3 T C 8: 70,291,355 V243A probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Ifi203 T C 1: 173,935,110 Q152R possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ighv1-24 A G 12: 114,773,128 Y51H probably benign Het
Inf2 A T 12: 112,612,039 probably null Het
Insl6 T C 19: 29,325,255 R21G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Ltbp3 T C 19: 5,756,823 C1043R probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mpeg1 T A 19: 12,461,181 M1K probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nek9 C A 12: 85,327,459 R268L possibly damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1186 T C 2: 88,526,041 S153P probably damaging Het
Olfr167 A G 16: 19,515,027 I203T probably benign Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr986 T C 9: 40,187,664 L183S probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Plagl1 A G 10: 13,127,261 Y91C probably damaging Het
Polr1a A G 6: 71,931,709 N506S possibly damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Ptprf C A 4: 118,211,999 G1624W probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Rc3h1 A G 1: 160,959,477 D814G possibly damaging Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Rusc2 A G 4: 43,415,240 D182G probably benign Het
Setd1b A G 5: 123,160,914 probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Smarcc2 A G 10: 128,463,940 D158G probably damaging Het
Sptbn1 A G 11: 30,113,854 probably null Het
St3gal5 T C 6: 72,132,053 C42R probably damaging Het
Syt7 T C 19: 10,443,428 S397P possibly damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Thada T A 17: 84,386,532 D1263V probably damaging Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tpcn1 A T 5: 120,548,269 probably null Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Ubxn2b A T 4: 6,214,746 Q260L probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp5 A G 6: 124,826,379 F7L probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn1r28 A T 6: 58,265,909 I246F probably benign Het
Vmn2r2 C A 3: 64,116,900 M753I probably benign Het
Zbtb26 T C 2: 37,435,929 H365R probably benign Het
Zfp976 A T 7: 42,612,930 Y494* probably null Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
franz_joseph UTSW 8 110601318 missense probably damaging 1.00
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTATTTAAGCCTTTGTGCCCG -3'
(R):5'- AGAACTGCTTGGGACAGGTAC -3'

Sequencing Primer
(F):5'- CCCGTTTTGAATTCAGGCTCAAGAG -3'
(R):5'- ACTGCACAGCTGGGGTTAG -3'
Posted On2016-06-06