Incidental Mutation 'R5071:Dnah11'
ID388807
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Namedynein, axonemal, heavy chain 11
Synonymsb2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
MMRRC Submission 042661-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R5071 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location117877982-118199043 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118082453 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1750 (L1750*)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
Predicted Effect probably null
Transcript: ENSMUST00000084806
AA Change: L1750*
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: L1750*

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI182371 A T 2: 35,085,215 I334N probably benign Het
Aldh1b1 A G 4: 45,803,383 probably null Het
Armc9 G A 1: 86,186,116 M298I probably benign Het
Atp8a1 T A 5: 67,815,723 K27N probably benign Het
BC004004 G A 17: 29,294,415 probably null Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh17 G T 4: 11,810,325 G672V probably damaging Het
Cdh5 C A 8: 104,140,702 T537K probably damaging Het
Chd1 T A 17: 15,762,405 S1377R probably benign Het
Chd2 T C 7: 73,429,689 N1821S probably benign Het
Cnot3 A G 7: 3,650,861 K4R probably damaging Het
Colq T A 14: 31,528,832 I339F possibly damaging Het
Coq2 A T 5: 100,667,950 L121Q probably damaging Het
Csnk1e G A 15: 79,420,872 R342* probably null Het
Cstl1 A T 2: 148,750,927 M1L probably benign Het
Cwh43 A G 5: 73,423,913 probably null Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dgkh T C 14: 78,604,532 K417E probably damaging Het
Edn1 A G 13: 42,303,677 E62G probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Fitm1 T A 14: 55,575,773 V31E possibly damaging Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gabrd A C 4: 155,387,162 F228C probably damaging Het
Gm5916 A C 9: 36,128,668 L8R probably benign Het
Gm9573 G A 17: 35,620,552 probably benign Het
Gpr108 A G 17: 57,235,335 S557P probably damaging Het
Gpr75 C A 11: 30,892,380 N428K probably damaging Het
H2-M5 T G 17: 36,987,184 probably null Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Homer3 T C 8: 70,291,355 V243A probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi203 T C 1: 173,935,110 Q152R possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ighv1-24 A G 12: 114,773,128 Y51H probably benign Het
Inf2 A T 12: 112,612,039 probably null Het
Insl6 T C 19: 29,325,255 R21G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Ltbp3 T C 19: 5,756,823 C1043R probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mpeg1 T A 19: 12,461,181 M1K probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nek9 C A 12: 85,327,459 R268L possibly damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1186 T C 2: 88,526,041 S153P probably damaging Het
Olfr167 A G 16: 19,515,027 I203T probably benign Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr986 T C 9: 40,187,664 L183S probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Plagl1 A G 10: 13,127,261 Y91C probably damaging Het
Polr1a A G 6: 71,931,709 N506S possibly damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Ptprf C A 4: 118,211,999 G1624W probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Rc3h1 A G 1: 160,959,477 D814G possibly damaging Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Rusc2 A G 4: 43,415,240 D182G probably benign Het
Setd1b A G 5: 123,160,914 probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Smarcc2 A G 10: 128,463,940 D158G probably damaging Het
Sptbn1 A G 11: 30,113,854 probably null Het
St3gal5 T C 6: 72,132,053 C42R probably damaging Het
Syt7 T C 19: 10,443,428 S397P possibly damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Thada T A 17: 84,386,532 D1263V probably damaging Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tpcn1 A T 5: 120,548,269 probably null Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Ubxn2b A T 4: 6,214,746 Q260L probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp5 A G 6: 124,826,379 F7L probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn1r28 A T 6: 58,265,909 I246F probably benign Het
Vmn2r2 C A 3: 64,116,900 M753I probably benign Het
Zbtb26 T C 2: 37,435,929 H365R probably benign Het
Zfp976 A T 7: 42,612,930 Y494* probably null Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0416:Dnah11 UTSW 12 117911058 missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118106510 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 synonymous probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1728:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117987676 intron probably null
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTTTAATCTGCATTGTCTGAC -3'
(R):5'- CTGGCTTCTGCAACTCGAAC -3'

Sequencing Primer
(F):5'- AATCTGCATTGTCTGACTTTGG -3'
(R):5'- TTCTGCAACTCGAACAGACCATG -3'
Posted On2016-06-06