Incidental Mutation 'R5072:Ufl1'
ID388855
Institutional Source Beutler Lab
Gene Symbol Ufl1
Ensembl Gene ENSMUSG00000040359
Gene NameUFM1 specific ligase 1
Synonyms1810074P20Rik, Maxer, Rcad
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location25248600-25281821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25254780 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 559 (Y559H)
Ref Sequence ENSEMBL: ENSMUSP00000100059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038705] [ENSMUST00000102994]
Predicted Effect probably benign
Transcript: ENSMUST00000038705
AA Change: Y479H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042118
Gene: ENSMUSG00000040359
AA Change: Y479H

DomainStartEndE-ValueType
Pfam:DUF2042 2 205 1.5e-70 PFAM
low complexity region 334 344 N/A INTRINSIC
low complexity region 348 358 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102994
AA Change: Y559H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100059
Gene: ENSMUSG00000040359
AA Change: Y559H

DomainStartEndE-ValueType
Pfam:DUF2042 7 284 4.8e-117 PFAM
low complexity region 414 424 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 444 454 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142949
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogensis, anemia and decreased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Ufl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ufl1 APN 4 25280631 missense possibly damaging 0.67
IGL00899:Ufl1 APN 4 25262238 missense probably damaging 1.00
IGL00928:Ufl1 APN 4 25267790 missense probably damaging 1.00
IGL00949:Ufl1 APN 4 25275822 missense probably damaging 0.99
IGL02179:Ufl1 APN 4 25254896 missense probably damaging 0.99
IGL02228:Ufl1 APN 4 25281686 missense probably benign
IGL02237:Ufl1 APN 4 25269082 missense probably benign 0.01
IGL02294:Ufl1 APN 4 25259281 nonsense probably null
IGL02331:Ufl1 APN 4 25251971 missense probably damaging 1.00
IGL02374:Ufl1 APN 4 25259237 missense probably benign 0.01
IGL02541:Ufl1 APN 4 25250534 missense possibly damaging 0.56
IGL03053:Ufl1 APN 4 25275833 missense probably damaging 0.99
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0172:Ufl1 UTSW 4 25280685 missense probably benign 0.32
R2069:Ufl1 UTSW 4 25269036 missense possibly damaging 0.75
R4320:Ufl1 UTSW 4 25278601 splice site probably null
R4467:Ufl1 UTSW 4 25254806 missense probably damaging 1.00
R4993:Ufl1 UTSW 4 25267832 missense possibly damaging 0.70
R5049:Ufl1 UTSW 4 25254773 missense probably benign 0.17
R5071:Ufl1 UTSW 4 25254780 missense probably benign
R5073:Ufl1 UTSW 4 25254780 missense probably benign
R5099:Ufl1 UTSW 4 25275914 missense probably damaging 0.99
R5108:Ufl1 UTSW 4 25269026 critical splice donor site probably null
R5127:Ufl1 UTSW 4 25256010 missense probably benign 0.05
R5262:Ufl1 UTSW 4 25251294 intron probably benign
R5409:Ufl1 UTSW 4 25280706 missense probably damaging 1.00
R5942:Ufl1 UTSW 4 25250619 missense probably benign
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6107:Ufl1 UTSW 4 25251999 missense possibly damaging 0.88
R6157:Ufl1 UTSW 4 25279350 missense possibly damaging 0.83
R6296:Ufl1 UTSW 4 25270572 missense probably benign
R6360:Ufl1 UTSW 4 25265476 missense probably benign
R6514:Ufl1 UTSW 4 25262238 missense probably damaging 1.00
R6754:Ufl1 UTSW 4 25267796 nonsense probably null
R6755:Ufl1 UTSW 4 25262316 missense probably damaging 0.96
V7732:Ufl1 UTSW 4 25251368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCACTTGTAATGGCTGCAGG -3'
(R):5'- TAACCATATTTATCTTGTCCCAGGC -3'

Sequencing Primer
(F):5'- TCCACTGCCATGAGGAAATCTGAG -3'
(R):5'- GTCCCAGGCCTCTTAATAAAATG -3'
Posted On2016-06-06