Incidental Mutation 'R5072:Fryl'
ID388862
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73074767 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1550 (P1550L)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect probably damaging
Transcript: ENSMUST00000094700
AA Change: P1550L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: P1550L

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101127
AA Change: P1550L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: P1550L

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175890
Predicted Effect probably benign
Transcript: ENSMUST00000201277
Predicted Effect unknown
Transcript: ENSMUST00000202381
AA Change: P419L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202413
Predicted Effect probably benign
Transcript: ENSMUST00000202697
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably null Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACTGTGCGGTGTCAGAC -3'
(R):5'- GTGTTAATAACCTTTCTGCCTTGG -3'

Sequencing Primer
(F):5'- TGTCAGACAGTGTCTAGGAAGCTG -3'
(R):5'- GCCTTGGTCTCCCTAGAAAATGTG -3'
Posted On2016-06-06