Incidental Mutation 'R5072:Ablim1'
ID388928
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Nameactin-binding LIM protein 1
Synonyms2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R5072 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location57032733-57314919 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 57073853 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000104902] [ENSMUST00000111526] [ENSMUST00000111528] [ENSMUST00000111529] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
Predicted Effect probably null
Transcript: ENSMUST00000079360
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099294
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000104902
SMART Domains Protein: ENSMUSP00000127818
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 1e-8 PDB
low complexity region 88 97 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
coiled coil region 358 382 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
VHP 510 545 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111526
SMART Domains Protein: ENSMUSP00000107151
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
PDB:1WIG|A 1 28 6e-9 PDB
coiled coil region 213 237 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
VHP 365 400 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111528
SMART Domains Protein: ENSMUSP00000107153
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 72 81 N/A INTRINSIC
coiled coil region 267 291 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
VHP 419 454 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111529
SMART Domains Protein: ENSMUSP00000107154
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 44 53 N/A INTRINSIC
coiled coil region 239 263 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
VHP 391 426 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111544
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111546
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111550
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111555
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111558
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111559
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q60* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 probably null Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably null Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably null Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo3b C A 2: 70,095,249 T20K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably null Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably null Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably null Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably null Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57152290 missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57061328 missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57215721 missense probably benign
IGL01385:Ablim1 APN 19 57068914 missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57039447 missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57134654 missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57079880 splice site probably benign
IGL02498:Ablim1 APN 19 57152319 nonsense probably null
A9681:Ablim1 UTSW 19 57173323 critical splice donor site probably null
R0089:Ablim1 UTSW 19 57043031 missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57043870 missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57134633 missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57068236 missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57215965 start gained probably null
R1936:Ablim1 UTSW 19 57215965 start gained probably null
R2021:Ablim1 UTSW 19 57047018 missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57043813 missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57077431 missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57152359 missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57152303 missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3733:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3734:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3878:Ablim1 UTSW 19 57037210 utr 3 prime probably null
R4354:Ablim1 UTSW 19 57155278 missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57077442 missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57215721 missense probably benign
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R5277:Ablim1 UTSW 19 57155261 missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57155249 missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57130923 missense probably benign 0.07
R5893:Ablim1 UTSW 19 57215853 missense probably benign 0.07
R5958:Ablim1 UTSW 19 57041935 missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57061355 missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57079839 missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57130852 missense probably benign 0.03
R6662:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R6705:Ablim1 UTSW 19 57215821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTACCTTAGGAGAGAGCTGGAAAG -3'
(R):5'- AAATAGTCTCTGGTTGGCAGG -3'

Sequencing Primer
(F):5'- GCTCTTTGCTGCCCCAC -3'
(R):5'- TTGGCAGGTGTGTGTACC -3'
Posted On2016-06-06