Incidental Mutation 'R5072:Atp7a'
ID388929
Institutional Source Beutler Lab
Gene Symbol Atp7a
Ensembl Gene ENSMUSG00000033792
Gene NameATPase, Cu++ transporting, alpha polypeptide
SynonymsMNK, br, Menkes protein
Accession Numbers

Genbank: NM_009726; MGI: 99400

Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R5072 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location106027276-106124926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106109768 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1093 (D1093G)
Ref Sequence ENSEMBL: ENSMUSP00000058840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055941] [ENSMUST00000113557]
Predicted Effect probably benign
Transcript: ENSMUST00000055941
AA Change: D1093G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058840
Gene: ENSMUSG00000033792
AA Change: D1093G

DomainStartEndE-ValueType
Pfam:HMA 11 72 1.8e-16 PFAM
Pfam:HMA 174 235 3.2e-14 PFAM
Pfam:HMA 280 342 1.5e-15 PFAM
low complexity region 348 362 N/A INTRINSIC
Pfam:HMA 380 441 1.2e-17 PFAM
Pfam:HMA 484 544 6.7e-14 PFAM
Pfam:HMA 559 620 7.3e-15 PFAM
transmembrane domain 644 666 N/A INTRINSIC
low complexity region 698 713 N/A INTRINSIC
Pfam:E1-E2_ATPase 777 1025 1.4e-62 PFAM
Pfam:Hydrolase 1030 1305 1.4e-66 PFAM
Pfam:HAD 1033 1302 3.3e-12 PFAM
Pfam:Hydrolase_3 1273 1337 6.2e-7 PFAM
transmembrane domain 1351 1373 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113557
AA Change: D1092G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109186
Gene: ENSMUSG00000033792
AA Change: D1092G

DomainStartEndE-ValueType
Pfam:HMA 11 72 2.7e-14 PFAM
Pfam:HMA 174 235 2e-13 PFAM
Pfam:HMA 280 344 2.4e-14 PFAM
low complexity region 348 362 N/A INTRINSIC
Pfam:HMA 380 441 5.1e-16 PFAM
Pfam:HMA 482 543 1.9e-12 PFAM
Pfam:HMA 558 619 1.8e-14 PFAM
transmembrane domain 643 665 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:E1-E2_ATPase 777 1025 2.2e-51 PFAM
Pfam:Hydrolase 1029 1304 3.9e-76 PFAM
Pfam:HAD 1032 1301 4.5e-14 PFAM
Pfam:Hydrolase_3 1272 1336 2.1e-6 PFAM
transmembrane domain 1350 1372 N/A INTRINSIC
transmembrane domain 1376 1398 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134363
Meta Mutation Damage Score 0.1472 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions in copper transport across membranes. This protein is localized to the trans Golgi network, where it is predicted to supply copper to copper-dependent enzymes in the secretory pathway. It relocalizes to the plasma membrane under conditions of elevated extracellular copper, and functions in the efflux of copper from cells. Mutations in this gene are associated with Menkes disease, X-linked distal spinal muscular atrophy, and occipital horn syndrome. Alternatively-spliced transcript variants have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mutations in this gene affect copper metabolism and, depending on the allele, result in abnormal pigmentation, vibrissae, hair, and skeleton. Behavior may be abnormal and defects of collagen and elastin fibers are reported. Some alleles are hemizygous lethal. [provided by MGI curators]
Allele List at MGI
All alleles(88) : Targeted, other(2) Gene trapped(48) Spontaneous(23) Chemically induced(9) Radiation induced(8)
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,600 H104Q probably benign Het
4933405L10Rik A G 8: 105,709,569 T158A possibly damaging Het
A1cf T C 19: 31,917,985 M156T probably benign Het
Abca15 A G 7: 120,406,975 Y1620C probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Ablim1 A G 19: 57,073,853 probably benign Het
Acox2 A T 14: 8,241,374 Y579* probably null Het
Adnp A T 2: 168,183,001 S791R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Alx3 G T 3: 107,604,793 S249I possibly damaging Het
Apob A G 12: 8,008,714 T2366A probably benign Het
Apool C T X: 112,349,843 Q95* probably null Het
Arid4a T C 12: 71,045,079 V213A probably benign Het
Bpifa5 A T 2: 154,165,972 E178V probably damaging Het
Car4 G A 11: 84,963,367 E47K probably benign Het
Catsper1 T C 19: 5,340,046 I567T possibly damaging Het
Ccdc63 T A 5: 122,121,055 Q260L probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ces5a C T 8: 93,534,668 V44M probably damaging Het
Cltc A G 11: 86,717,968 I741T possibly damaging Het
Cnst C A 1: 179,622,886 D638E possibly damaging Het
Col13a1 A G 10: 61,874,018 V92A silent Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Ddx20 A G 3: 105,682,875 probably benign Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Epha4 T C 1: 77,445,002 Y281C probably damaging Het
Fbxo42 T C 4: 141,198,945 W313R probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
Gtf2ird1 G T 5: 134,390,933 probably benign Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Homo
Hist2h2ac C T 3: 96,220,783 R21Q probably benign Het
Hspg2 T C 4: 137,540,230 S2050P probably damaging Het
Irgc1 T C 7: 24,432,771 D207G probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krtap1-4 C G 11: 99,583,616 A5P probably benign Het
Lrrfip2 A G 9: 111,199,804 E365G probably damaging Het
Ly75 A G 2: 60,375,963 Y121H probably damaging Het
Man2a1 G A 17: 64,659,079 probably benign Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Mllt10 C A 2: 18,109,874 H52N possibly damaging Het
Myo1a T C 10: 127,707,419 probably benign Het
Myo3b C A 2: 70,095,249 T48K possibly damaging Het
Nipsnap2 A T 5: 129,739,580 K62N probably damaging Het
Nr1i3 C T 1: 171,216,813 T169I probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr420 A T 1: 174,158,961 I63F probably damaging Het
Olfr639 T A 7: 104,012,118 R195W probably damaging Het
Oprm1 A G 10: 6,832,550 S398G probably benign Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably benign Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pitrm1 T C 13: 6,553,190 F91S probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Pygb C T 2: 150,801,578 T95M probably damaging Het
Rassf9 A G 10: 102,545,905 K383E probably damaging Het
Rfk T A 19: 17,398,599 F86I possibly damaging Het
Rims2 T C 15: 39,462,590 F773L probably benign Het
Sdcbp A G 4: 6,393,019 I218V probably benign Het
Slc4a2 G A 5: 24,438,762 S864N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spen A T 4: 141,522,302 S58R unknown Het
St3gal2 T C 8: 110,957,718 C3R possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Stat5b T C 11: 100,808,535 probably benign Het
Tmco3 G T 8: 13,292,860 E199* probably null Het
Tmem26 A G 10: 68,775,348 T216A probably damaging Het
Ttn A G 2: 76,720,478 probably benign Het
Ttn C T 2: 76,746,402 V24716I probably damaging Het
Ttn A T 2: 76,772,365 probably benign Het
Uba5 T C 9: 104,054,427 E202G probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Utrn A T 10: 12,384,204 probably benign Het
Vmn2r111 C A 17: 22,548,041 C825F probably damaging Het
Vmn2r113 T A 17: 22,958,355 C704* probably null Het
Vmn2r56 A G 7: 12,694,056 I761T probably benign Het
Vmn2r98 C T 17: 19,066,044 T268I probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp473 T A 7: 44,732,519 I797F probably damaging Het
Zfp68 A T 5: 138,606,317 D543E probably benign Het
Other mutations in Atp7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Atp7a APN X 106109830 unclassified probably damaging 0.97
IGL02023:Atp7a APN X 106094982 unclassified probably damaging 0.99
IGL02597:Atp7a APN X 106069888 unclassified probably benign 0.44
IGL03285:Atp7a APN X 106109775 unclassified probably benign
brown UTSW X 106088491 missense possibly damaging 0.48
Golden UTSW X unclassified
Silver UTSW X unclassified
Tigrou UTSW X 106088407 nonsense
Tigrou-like UTSW X 106105250 missense probably damaging 1.00
Ups UTSW X 106088491 missense possibly damaging 0.48
R0240:Atp7a UTSW X 106109841 missense probably damaging 1.00
R0240:Atp7a UTSW X 106109841 missense probably damaging 1.00
R3434:Atp7a UTSW X 106094857 missense probably benign 0.00
R3435:Atp7a UTSW X 106094857 missense probably benign 0.00
R3756:Atp7a UTSW X 106101843 intron probably benign
R4911:Atp7a UTSW X 106120374 missense probably damaging 0.99
R5073:Atp7a UTSW X 106109768 missense probably benign
R5074:Atp7a UTSW X 106109768 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATCATCAGAGGCTCACAGTTTC -3'
(R):5'- CAACTTACTTGAGAGATGAGCATC -3'

Sequencing Primer
(F):5'- GAGGCTCACAGTTTCATTTTTCATG -3'
(R):5'- ACTTGAGAGATGAGCATCAATAATC -3'
Posted OnJun 06, 2016