Incidental Mutation 'R0433:Slc4a10'
ID38896
Institutional Source Beutler Lab
Gene Symbol Slc4a10
Ensembl Gene ENSMUSG00000026904
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter-like, member 10
SynonymsNCBE
MMRRC Submission 038635-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0433 (G1)
Quality Score111
Status Validated
Chromosome2
Chromosomal Location62046462-62326730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62289983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 788 (I788S)
Ref Sequence ENSEMBL: ENSMUSP00000061411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]
Predicted Effect probably benign
Transcript: ENSMUST00000054484
AA Change: I788S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: I788S

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 9e-107 PFAM
Pfam:HCO3_cotransp 445 959 1e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102735
AA Change: I788S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: I788S

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 2e-106 PFAM
Pfam:HCO3_cotransp 445 959 2.4e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112480
AA Change: I818S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: I818S

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 435 9.6e-108 PFAM
Pfam:HCO3_cotransp 476 989 1.5e-245 PFAM
transmembrane domain 997 1019 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155219
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 99% (108/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,303 V199A possibly damaging Het
2410089E03Rik T C 15: 8,216,562 S1473P probably benign Het
Abcb5 T C 12: 118,877,810 M967V probably benign Het
Adcy10 T A 1: 165,552,022 L951Q probably damaging Het
Amer2 A T 14: 60,378,583 S76C probably damaging Het
Atad1 T C 19: 32,698,477 I182M probably benign Het
Bpi A G 2: 158,258,419 D42G probably damaging Het
C7 G T 15: 4,988,916 T815K probably damaging Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Camk1g A G 1: 193,354,058 F165L probably damaging Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccser2 A C 14: 36,918,529 F37L probably damaging Het
Cfap43 A G 19: 47,825,771 F208S probably benign Het
Cfap54 G A 10: 92,979,080 probably benign Het
Cfap69 A C 5: 5,649,853 D62E probably damaging Het
Cnksr2 C A X: 157,888,557 M483I probably benign Het
Cnksr2 A T X: 157,888,558 M483K probably benign Het
Cog8 T C 8: 107,056,478 S60G possibly damaging Het
Col4a3 C T 1: 82,670,219 P484S unknown Het
Col6a4 C T 9: 106,067,994 G974R probably damaging Het
Dbnl T G 11: 5,796,825 probably null Het
Dhcr7 T C 7: 143,840,463 C114R possibly damaging Het
Dnah2 C A 11: 69,459,288 D2340Y probably damaging Het
Dusp10 T A 1: 184,069,196 Y387N probably damaging Het
Eipr1 C T 12: 28,859,331 T199I possibly damaging Het
Emc2 T G 15: 43,497,124 probably null Het
Enpp3 A G 10: 24,820,597 S147P probably benign Het
Fam133b T A 5: 3,558,560 probably benign Het
Fam205c A G 4: 42,874,013 probably benign Het
Fat1 C A 8: 45,024,649 T2244K possibly damaging Het
Fbn1 A G 2: 125,348,215 S1453P possibly damaging Het
Fez2 A T 17: 78,418,047 F13I probably damaging Het
Ggnbp2 T C 11: 84,836,420 K530R probably damaging Het
Gm597 A T 1: 28,777,342 Y536* probably null Het
Gpa33 T C 1: 166,163,761 probably benign Het
Gpr142 T C 11: 114,805,997 I123T probably damaging Het
Il21 T G 3: 37,232,535 I11L possibly damaging Het
Klhl7 A G 5: 24,127,702 E86G probably damaging Het
Klk10 G T 7: 43,781,565 A11S possibly damaging Het
Knl1 A T 2: 119,104,061 D2115V probably damaging Het
Lonp2 A G 8: 86,633,954 D185G probably damaging Het
Lrrc47 T C 4: 154,018,365 probably benign Het
Lrrcc1 A G 3: 14,559,374 I698V probably damaging Het
Lzts2 T C 19: 45,021,676 V83A possibly damaging Het
Melk C A 4: 44,340,614 probably benign Het
Mical1 G A 10: 41,479,490 V150I probably benign Het
Morn3 C A 5: 123,039,333 M129I probably benign Het
Mroh2b T A 15: 4,941,634 D1040E probably benign Het
Mroh5 T C 15: 73,790,028 N438S probably benign Het
Mroh5 T A 15: 73,790,808 Q387L probably damaging Het
Myh15 A G 16: 49,145,236 D1168G probably damaging Het
Nek10 A G 14: 14,860,927 E493G probably benign Het
Nipsnap3a A G 4: 53,000,316 Y227C probably damaging Het
Nlrp9c T A 7: 26,385,819 T112S probably benign Het
Nphp4 T C 4: 152,518,172 V401A probably benign Het
Nr1h2 A G 7: 44,549,987 *365Q probably null Het
Olfr1339 T C 4: 118,735,090 V187A probably benign Het
Olfr474 T C 7: 107,955,262 I207T probably damaging Het
Pacs2 T A 12: 113,056,844 V279D possibly damaging Het
Pdcd2 C T 17: 15,526,384 C171Y probably benign Het
Pde11a T A 2: 76,337,706 D301V possibly damaging Het
Pfpl T G 19: 12,429,475 N363K probably damaging Het
Phf14 T A 6: 11,933,743 S201R probably damaging Het
Pip4k2c G A 10: 127,208,946 P66S probably benign Het
Pou2f3 G T 9: 43,127,398 H392N probably benign Het
Pou3f1 G T 4: 124,658,904 G400C probably damaging Het
Ptprg T C 14: 12,220,620 I1219T probably damaging Het
Rfx6 A G 10: 51,720,028 D435G probably damaging Het
Rhpn2 T A 7: 35,385,474 S598T probably benign Het
Sdccag8 C A 1: 176,844,821 probably null Het
Sec16b C A 1: 157,534,709 Y43* probably null Het
Sele T C 1: 164,049,244 Y30H possibly damaging Het
Sgsm2 C T 11: 74,858,190 probably null Het
Slc45a2 T C 15: 11,025,745 Y394H probably benign Het
Slmap A T 14: 26,453,594 L161* probably null Het
Slx4 A T 16: 3,986,018 D977E probably benign Het
Spen A T 4: 141,483,758 M608K unknown Het
St8sia4 G C 1: 95,591,704 T353R probably damaging Het
Stab2 G T 10: 86,843,491 probably benign Het
Stx12 C T 4: 132,858,430 G213D probably damaging Het
Synj2 A T 17: 6,033,848 N270Y probably damaging Het
Tdrd9 C T 12: 112,025,581 R438* probably null Het
Tert T C 13: 73,627,081 Y18H probably damaging Het
Tph1 A T 7: 46,653,821 F244L probably damaging Het
Triobp T C 15: 78,968,201 F852L possibly damaging Het
Trpv1 T C 11: 73,253,008 probably benign Het
Uggt2 A T 14: 119,075,329 probably null Het
Ulk4 A G 9: 121,044,819 I1182T probably benign Het
Uqcc1 A G 2: 155,910,368 Y98H probably damaging Het
Usp25 A G 16: 77,109,217 I854V probably benign Het
Usp50 T C 2: 126,761,544 S361G probably damaging Het
Uspl1 C A 5: 149,214,815 Q743K probably damaging Het
Vmn2r3 A G 3: 64,275,633 V215A possibly damaging Het
Vmn2r61 A T 7: 42,265,911 H94L probably benign Het
Vps37c T C 19: 10,713,029 V285A probably benign Het
Vwa8 T C 14: 79,062,676 V983A probably damaging Het
Wdr78 T C 4: 103,103,253 N67D probably benign Het
Zcchc9 C T 13: 91,805,962 R58H probably benign Het
Zdbf2 T C 1: 63,306,143 V1227A possibly damaging Het
Zfp292 T C 4: 34,839,959 K64E probably damaging Het
Zfp948 A G 17: 21,587,502 T319A probably benign Het
Zp3r T G 1: 130,577,133 probably benign Het
Other mutations in Slc4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Slc4a10 APN 2 62290001 missense probably damaging 1.00
IGL00990:Slc4a10 APN 2 62286940 missense probably damaging 1.00
IGL01294:Slc4a10 APN 2 62253309 critical splice acceptor site probably null
IGL01628:Slc4a10 APN 2 62268666 missense probably damaging 1.00
IGL01773:Slc4a10 APN 2 62190757 missense probably damaging 0.97
IGL02119:Slc4a10 APN 2 62228670 missense probably damaging 1.00
IGL02125:Slc4a10 APN 2 62268171 missense probably benign 0.02
IGL02406:Slc4a10 APN 2 62190769 missense probably benign 0.37
IGL02890:Slc4a10 APN 2 62286916 missense probably damaging 1.00
IGL02959:Slc4a10 APN 2 62268143 missense probably damaging 1.00
IGL02979:Slc4a10 APN 2 62288747 missense probably null 1.00
IGL03144:Slc4a10 APN 2 62250466 missense probably benign 0.00
IGL03175:Slc4a10 APN 2 62296960 missense probably damaging 0.99
IGL03383:Slc4a10 APN 2 62267436 missense probably damaging 1.00
IGL03412:Slc4a10 APN 2 62250543 splice site probably benign
R0085:Slc4a10 UTSW 2 62244346 splice site probably benign
R0401:Slc4a10 UTSW 2 62190848 missense probably benign 0.27
R0482:Slc4a10 UTSW 2 62297017 splice site probably benign
R0506:Slc4a10 UTSW 2 62250533 missense probably benign 0.13
R0511:Slc4a10 UTSW 2 62286862 missense probably damaging 0.97
R0590:Slc4a10 UTSW 2 62190893 splice site probably benign
R0883:Slc4a10 UTSW 2 62243398 missense probably benign 0.11
R1167:Slc4a10 UTSW 2 62228574 missense probably damaging 1.00
R1276:Slc4a10 UTSW 2 62250443 missense probably damaging 0.99
R1395:Slc4a10 UTSW 2 62313286 missense probably benign 0.00
R1455:Slc4a10 UTSW 2 62286930 missense probably damaging 1.00
R1589:Slc4a10 UTSW 2 62257462 missense probably damaging 1.00
R1677:Slc4a10 UTSW 2 62324727 missense probably benign
R1848:Slc4a10 UTSW 2 62316606 missense probably damaging 1.00
R1987:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R1988:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R2018:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2019:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2407:Slc4a10 UTSW 2 62313343 missense probably benign
R4067:Slc4a10 UTSW 2 62046645 start codon destroyed probably benign 0.00
R4184:Slc4a10 UTSW 2 62317442 intron probably benign
R4255:Slc4a10 UTSW 2 62281936 missense probably benign 0.10
R4282:Slc4a10 UTSW 2 62244343 splice site probably null
R4296:Slc4a10 UTSW 2 62234428 missense possibly damaging 0.80
R4361:Slc4a10 UTSW 2 62243385 missense probably benign 0.00
R4596:Slc4a10 UTSW 2 62296858 missense probably damaging 1.00
R4709:Slc4a10 UTSW 2 62257517 missense probably null 1.00
R4755:Slc4a10 UTSW 2 62296988 missense probably damaging 1.00
R4836:Slc4a10 UTSW 2 62268187 missense probably damaging 1.00
R4841:Slc4a10 UTSW 2 62257595 missense possibly damaging 0.68
R4998:Slc4a10 UTSW 2 62244439 missense probably benign 0.00
R5069:Slc4a10 UTSW 2 62267571 missense probably benign 0.06
R5223:Slc4a10 UTSW 2 62253366 missense probably damaging 1.00
R5244:Slc4a10 UTSW 2 62288725 missense probably damaging 1.00
R5386:Slc4a10 UTSW 2 62290058 missense probably damaging 1.00
R5808:Slc4a10 UTSW 2 62250472 missense probably damaging 1.00
R5999:Slc4a10 UTSW 2 62243431 missense probably benign 0.10
R6007:Slc4a10 UTSW 2 62268872 missense probably benign 0.44
R6009:Slc4a10 UTSW 2 62046690 missense probably benign 0.00
R6015:Slc4a10 UTSW 2 62228702 missense probably benign 0.05
R6103:Slc4a10 UTSW 2 62234465 missense probably damaging 1.00
R6141:Slc4a10 UTSW 2 62211445 missense probably damaging 1.00
R6193:Slc4a10 UTSW 2 62243357 splice site probably null
R6217:Slc4a10 UTSW 2 62303951 missense probably benign 0.27
R6280:Slc4a10 UTSW 2 62281966 missense probably benign 0.05
R6523:Slc4a10 UTSW 2 62286961 nonsense probably null
R6643:Slc4a10 UTSW 2 62228710 missense possibly damaging 0.96
R6660:Slc4a10 UTSW 2 62250403 missense possibly damaging 0.55
U24488:Slc4a10 UTSW 2 62046658 missense probably benign 0.05
X0019:Slc4a10 UTSW 2 62228599 missense probably damaging 1.00
Z1088:Slc4a10 UTSW 2 62228571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAGTTATGTGAATGCTCCGCGAG -3'
(R):5'- ATAGTGGAATCCCAGACGGAAGCC -3'

Sequencing Primer
(F):5'- CTTAGTGAATGCTCAGCCAATC -3'
(R):5'- CCCCTTTAGAAGTAAGGTTTCAGAC -3'
Posted On2013-05-23