Incidental Mutation 'R5073:Hydin'
ID388983
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
MMRRC Submission 042662-MU
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R5073 (G1)
Quality Score187
Status Validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110538473 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 2763 (N2763D)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
Predicted Effect probably benign
Transcript: ENSMUST00000043141
AA Change: N2763D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: N2763D

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ahnak T A 19: 9,003,231 H626Q probably benign Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bcas3 A G 11: 85,371,132 Y110C probably damaging Het
Brpf1 T C 6: 113,310,254 S148P probably damaging Het
Capn3 A G 2: 120,491,820 H339R probably damaging Het
Ccdc141 A T 2: 77,124,378 probably null Het
Ccl2 A G 11: 82,037,158 probably benign Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cit T A 5: 115,946,843 M811K probably benign Het
Crim1 T C 17: 78,281,347 C284R possibly damaging Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dbndd2 A G 2: 164,490,304 probably benign Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Elavl1 A G 8: 4,301,741 M125T possibly damaging Het
Eml4 C A 17: 83,463,577 S723R probably damaging Het
Fgf15 A C 7: 144,896,839 Y54S possibly damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hmga1b C T 11: 120,763,186 Q100* probably null Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ifnlr1 A G 4: 135,705,146 T298A probably benign Het
Impdh2 G A 9: 108,563,336 probably null Het
Insr A G 8: 3,159,475 F1203L probably damaging Het
Kcnq4 A G 4: 120,717,517 S117P probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kif1a T C 1: 93,022,505 H1400R probably damaging Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krt222 T A 11: 99,243,970 probably benign Het
Lekr1 A T 3: 65,819,794 noncoding transcript Het
Ltn1 A G 16: 87,427,740 V32A probably damaging Het
March1 T A 8: 66,386,368 W21R probably benign Het
March5 A G 19: 37,210,808 N58S possibly damaging Het
Mast4 G A 13: 102,738,883 Q1158* probably null Het
Mib2 C G 4: 155,656,776 A535P probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Msc C T 1: 14,754,313 V178M probably benign Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Mvk A T 5: 114,452,952 probably benign Het
Myo1a T C 10: 127,707,419 probably null Het
Myo6 T G 9: 80,288,008 S887A probably benign Het
Myo7a G A 7: 98,073,218 Q1167* probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nmnat1 C A 4: 149,469,138 M172I probably benign Het
Nudt1 G T 5: 140,331,907 probably null Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1508 T A 14: 52,463,575 M118L probably damaging Het
Olfr24 T C 9: 18,754,822 E271G possibly damaging Het
Parp14 A T 16: 35,834,707 I1798K probably damaging Het
Pcdhga7 A G 18: 37,715,972 D344G probably damaging Het
Pck1 A G 2: 173,156,977 T343A probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prpf38b A G 3: 108,911,168 F92S probably damaging Het
Psmc3 A G 2: 91,054,570 probably benign Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rgs9 C A 11: 109,227,331 A332S probably benign Het
Rptor T C 11: 119,896,479 I1290T possibly damaging Het
Slc38a7 C A 8: 95,841,650 R369L probably damaging Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slco2a1 G T 9: 103,046,726 L46F probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tbc1d9 A G 8: 83,233,547 E143G probably damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tg A C 15: 66,735,252 M213L probably benign Het
Tnc A G 4: 64,020,411 C64R probably damaging Het
Tpd52l1 A G 10: 31,357,920 L79S probably damaging Het
Tpp2 C A 1: 43,954,736 S260R possibly damaging Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Tshz2 A T 2: 169,962,573 probably benign Het
Tuba8 T C 6: 121,222,903 V182A probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp53 A T 3: 122,933,946 S996T probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Wdr17 T A 8: 54,690,236 probably null Het
Wdr6 G A 9: 108,574,366 H773Y probably damaging Het
Wnk4 T G 11: 101,261,188 F173V probably damaging Het
Xrcc5 T C 1: 72,339,029 Y395H probably damaging Het
Zcwpw1 T A 5: 137,795,519 M1K probably null Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp652 A G 11: 95,750,064 I272V possibly damaging Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
franz_joseph UTSW 8 110601318 missense probably damaging 1.00
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTATTTAAGCCTTTGTGCCCG -3'
(R):5'- GAGAACTGCTTGGGACAGGTAC -3'

Sequencing Primer
(F):5'- CCCGTTTTGAATTCAGGCTCAAGAG -3'
(R):5'- ACTGCACAGCTGGGGTTAG -3'
Posted On2016-06-06