Incidental Mutation 'R5073:Rptor'
ID389008
Institutional Source Beutler Lab
Gene Symbol Rptor
Ensembl Gene ENSMUSG00000025583
Gene Nameregulatory associated protein of MTOR, complex 1
Synonymsraptor, Rap, 4932417H02Rik
MMRRC Submission 042662-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5073 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location119602905-119899576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119896479 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1290 (I1290T)
Ref Sequence ENSEMBL: ENSMUSP00000026671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000147781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026671
AA Change: I1290T

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: I1290T

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Pfam:HEAT_2 559 668 7.9e-11 PFAM
Pfam:HEAT 602 630 1.9e-6 PFAM
low complexity region 755 772 N/A INTRINSIC
low complexity region 877 887 N/A INTRINSIC
low complexity region 939 945 N/A INTRINSIC
WD40 1012 1050 2.56e1 SMART
WD40 1052 1097 4.28e0 SMART
WD40 1105 1151 1.83e2 SMART
WD40 1154 1194 1.82e-2 SMART
WD40 1200 1240 5.35e-1 SMART
WD40 1246 1281 7.13e0 SMART
WD40 1283 1329 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136662
SMART Domains Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147781
SMART Domains Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ahnak T A 19: 9,003,231 H626Q probably benign Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bcas3 A G 11: 85,371,132 Y110C probably damaging Het
Brpf1 T C 6: 113,310,254 S148P probably damaging Het
Capn3 A G 2: 120,491,820 H339R probably damaging Het
Ccdc141 A T 2: 77,124,378 probably null Het
Ccl2 A G 11: 82,037,158 probably benign Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cit T A 5: 115,946,843 M811K probably benign Het
Crim1 T C 17: 78,281,347 C284R possibly damaging Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dbndd2 A G 2: 164,490,304 probably benign Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Elavl1 A G 8: 4,301,741 M125T possibly damaging Het
Eml4 C A 17: 83,463,577 S723R probably damaging Het
Fgf15 A C 7: 144,896,839 Y54S possibly damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hmga1b C T 11: 120,763,186 Q100* probably null Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ifnlr1 A G 4: 135,705,146 T298A probably benign Het
Impdh2 G A 9: 108,563,336 probably null Het
Insr A G 8: 3,159,475 F1203L probably damaging Het
Kcnq4 A G 4: 120,717,517 S117P probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kif1a T C 1: 93,022,505 H1400R probably damaging Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krt222 T A 11: 99,243,970 probably benign Het
Lekr1 A T 3: 65,819,794 noncoding transcript Het
Ltn1 A G 16: 87,427,740 V32A probably damaging Het
March1 T A 8: 66,386,368 W21R probably benign Het
March5 A G 19: 37,210,808 N58S possibly damaging Het
Mast4 G A 13: 102,738,883 Q1158* probably null Het
Mib2 C G 4: 155,656,776 A535P probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Msc C T 1: 14,754,313 V178M probably benign Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Mvk A T 5: 114,452,952 probably benign Het
Myo1a T C 10: 127,707,419 probably null Het
Myo6 T G 9: 80,288,008 S887A probably benign Het
Myo7a G A 7: 98,073,218 Q1167* probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nmnat1 C A 4: 149,469,138 M172I probably benign Het
Nudt1 G T 5: 140,331,907 probably null Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1508 T A 14: 52,463,575 M118L probably damaging Het
Olfr24 T C 9: 18,754,822 E271G possibly damaging Het
Parp14 A T 16: 35,834,707 I1798K probably damaging Het
Pcdhga7 A G 18: 37,715,972 D344G probably damaging Het
Pck1 A G 2: 173,156,977 T343A probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prpf38b A G 3: 108,911,168 F92S probably damaging Het
Psmc3 A G 2: 91,054,570 probably benign Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rgs9 C A 11: 109,227,331 A332S probably benign Het
Slc38a7 C A 8: 95,841,650 R369L probably damaging Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slco2a1 G T 9: 103,046,726 L46F probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tbc1d9 A G 8: 83,233,547 E143G probably damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tg A C 15: 66,735,252 M213L probably benign Het
Tnc A G 4: 64,020,411 C64R probably damaging Het
Tpd52l1 A G 10: 31,357,920 L79S probably damaging Het
Tpp2 C A 1: 43,954,736 S260R possibly damaging Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Tshz2 A T 2: 169,962,573 probably benign Het
Tuba8 T C 6: 121,222,903 V182A probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp53 A T 3: 122,933,946 S996T probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Wdr17 T A 8: 54,690,236 probably null Het
Wdr6 G A 9: 108,574,366 H773Y probably damaging Het
Wnk4 T G 11: 101,261,188 F173V probably damaging Het
Xrcc5 T C 1: 72,339,029 Y395H probably damaging Het
Zcwpw1 T A 5: 137,795,519 M1K probably null Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp652 A G 11: 95,750,064 I272V possibly damaging Het
Other mutations in Rptor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Rptor APN 11 119799445 missense possibly damaging 0.92
IGL01319:Rptor APN 11 119891170 missense probably benign 0.01
IGL01375:Rptor APN 11 119896436 missense possibly damaging 0.68
IGL01899:Rptor APN 11 119857453 missense probably benign 0.04
IGL01927:Rptor APN 11 119657674 missense probably damaging 1.00
IGL02312:Rptor APN 11 119846915 missense possibly damaging 0.84
IGL02620:Rptor APN 11 119780587 missense probably benign 0.12
IGL02651:Rptor APN 11 119892612 missense possibly damaging 0.69
IGL03182:Rptor APN 11 119725145 missense probably damaging 1.00
R0103:Rptor UTSW 11 119884967 missense probably benign 0.01
R0179:Rptor UTSW 11 119872367 missense probably benign 0.14
R0217:Rptor UTSW 11 119894912 splice site probably benign
R0219:Rptor UTSW 11 119821777 intron probably benign
R0324:Rptor UTSW 11 119892641 missense probably damaging 1.00
R0432:Rptor UTSW 11 119780553 nonsense probably null
R0718:Rptor UTSW 11 119872376 missense probably benign 0.15
R0730:Rptor UTSW 11 119884954 missense probably benign 0.06
R1019:Rptor UTSW 11 119843743 missense probably damaging 1.00
R1073:Rptor UTSW 11 119743891 missense possibly damaging 0.93
R1424:Rptor UTSW 11 119780593 nonsense probably null
R1579:Rptor UTSW 11 119896001 missense probably benign 0.00
R1766:Rptor UTSW 11 119725061 missense probably damaging 0.99
R1844:Rptor UTSW 11 119756320 missense probably damaging 1.00
R2180:Rptor UTSW 11 119725144 missense probably damaging 1.00
R2274:Rptor UTSW 11 119756322 nonsense probably null
R2275:Rptor UTSW 11 119756322 nonsense probably null
R2408:Rptor UTSW 11 119857451 missense probably damaging 0.99
R2981:Rptor UTSW 11 119865594 missense probably damaging 1.00
R2996:Rptor UTSW 11 119856298 missense probably damaging 1.00
R3001:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3002:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3003:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R4358:Rptor UTSW 11 119671345 missense probably damaging 0.98
R4592:Rptor UTSW 11 119798840 missense probably null 1.00
R4647:Rptor UTSW 11 119891163 missense probably benign 0.33
R4666:Rptor UTSW 11 119743882 missense probably damaging 1.00
R4958:Rptor UTSW 11 119857391 missense probably benign 0.29
R4974:Rptor UTSW 11 119821640 intron probably benign
R5199:Rptor UTSW 11 119603816 missense probably benign
R5216:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5219:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5277:Rptor UTSW 11 119822956 missense probably damaging 1.00
R5365:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5366:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5447:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5630:Rptor UTSW 11 119756249 missense probably benign 0.01
R6220:Rptor UTSW 11 119897442 missense possibly damaging 0.83
R6567:Rptor UTSW 11 119896012 missense probably benign 0.00
R6741:Rptor UTSW 11 119895977 missense possibly damaging 0.92
R6915:Rptor UTSW 11 119756345 missense probably damaging 0.99
R7032:Rptor UTSW 11 119846936 missense probably benign 0.00
X0050:Rptor UTSW 11 119846405 missense probably benign 0.14
X0066:Rptor UTSW 11 119857866 missense probably benign 0.31
Z0001:Rptor UTSW 11 119603972 critical splice donor site probably null
Z0001:Rptor UTSW 11 119756236 splice site probably null
Z0001:Rptor UTSW 11 119756415 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119799319 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119846752 critical splice acceptor site probably null
Z0001:Rptor UTSW 11 119851468 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119857453 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119871492 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119874151 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119896549 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTGACAGTAACAGATGCGC -3'
(R):5'- CCTTAGAGTCAGGGAGGAGATC -3'

Sequencing Primer
(F):5'- TGACACAGAGATGGACCTCCTAG -3'
(R):5'- AGATCAGGCTTGCCGGGTTAC -3'
Posted On2016-06-06