Incidental Mutation 'R5018:Hhat'
ID389041
Institutional Source Beutler Lab
Gene Symbol Hhat
Ensembl Gene ENSMUSG00000037375
Gene Namehedgehog acyltransferase
Synonyms2810432O22Rik, Skn, AP-2CRE, Tg(TFAP2A-cre)1Will
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location192496711-192771223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 192595038 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 371 (L371Q)
Ref Sequence ENSEMBL: ENSMUSP00000141575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044190] [ENSMUST00000128619] [ENSMUST00000192585]
Predicted Effect probably damaging
Transcript: ENSMUST00000044190
AA Change: L371Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046686
Gene: ENSMUSG00000037375
AA Change: L371Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 5.7e-51 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128619
AA Change: L371Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120479
Gene: ENSMUSG00000037375
AA Change: L371Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 3.1e-60 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192585
AA Change: L371Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141575
Gene: ENSMUSG00000037375
AA Change: L371Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 2.4e-51 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 'Skinny hedgehog' (SKI1) encodes an enzyme that acts within the secretory pathway to catalyze amino-terminal palmitoylation of 'hedgehog' (see MIM 600725).[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygous null mice display neonatal lethality, holoprosencephaly, short-limb dwarfism, and oligodactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Hhat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Hhat APN 1 192717017 missense probably damaging 1.00
IGL02578:Hhat APN 1 192693913 missense probably damaging 0.98
R0420:Hhat UTSW 1 192552934 splice site probably null
R0842:Hhat UTSW 1 192726331 missense probably benign 0.07
R1794:Hhat UTSW 1 192693906 nonsense probably null
R1978:Hhat UTSW 1 192717107 missense probably benign 0.03
R2073:Hhat UTSW 1 192727379 missense possibly damaging 0.94
R2571:Hhat UTSW 1 192553022 missense probably damaging 1.00
R2891:Hhat UTSW 1 192595086 missense probably damaging 1.00
R4685:Hhat UTSW 1 192595054 missense probably damaging 1.00
R4781:Hhat UTSW 1 192686979 intron probably benign
R4988:Hhat UTSW 1 192657294 intron probably benign
R5002:Hhat UTSW 1 192543190 missense probably benign 0.23
R5023:Hhat UTSW 1 192727339 missense probably damaging 1.00
R5695:Hhat UTSW 1 192717019 missense probably damaging 0.99
R6151:Hhat UTSW 1 192759757 missense probably damaging 1.00
R6239:Hhat UTSW 1 192595087 missense probably damaging 1.00
R7007:Hhat UTSW 1 192693826 missense possibly damaging 0.51
R7079:Hhat UTSW 1 192553046 missense possibly damaging 0.95
R7534:Hhat UTSW 1 192726304 missense not run
Predicted Primers PCR Primer
(F):5'- AAACTAGTCCCTCCTTGCTCAG -3'
(R):5'- TCTACAGCTTCCTGGAAGTGG -3'

Sequencing Primer
(F):5'- TACCACACAGGCAATGATGG -3'
(R):5'- CAGCTTCCTGGAAGTGGGATTTTTC -3'
Posted On2016-06-06