Incidental Mutation 'R5018:Agbl5'
ID389049
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene NameATP/GTP binding protein-like 5
Synonyms
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30888694-30906965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30903059 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 141 (R141Q)
Ref Sequence ENSEMBL: ENSMUSP00000144441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114700] [ENSMUST00000132034] [ENSMUST00000132253] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
Predicted Effect probably damaging
Transcript: ENSMUST00000114700
AA Change: R728Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: R728Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132034
Predicted Effect probably benign
Transcript: ENSMUST00000132253
SMART Domains Protein: ENSMUSP00000128352
Gene: ENSMUSG00000038803

DomainStartEndE-ValueType
Pfam:Ost4 1 35 3.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134956
AA Change: R825Q
Predicted Effect not run
Transcript: ENSMUST00000151117
AA Change: R18Q
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: R699Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: R699Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201225
AA Change: R699Q

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165
AA Change: R699Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: R699Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: R699Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201917
AA Change: R699Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: R699Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202060
AA Change: R699Q

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165
AA Change: R699Q

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202109
AA Change: R141Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202893
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 30893234 missense probably benign 0.00
sausage UTSW 5 30894358 nonsense probably null
R0355:Agbl5 UTSW 5 30891991 critical splice donor site probably null
R0575:Agbl5 UTSW 5 30894454 missense probably damaging 1.00
R1694:Agbl5 UTSW 5 30893382 missense probably damaging 1.00
R1709:Agbl5 UTSW 5 30906241 missense probably damaging 1.00
R1829:Agbl5 UTSW 5 30903064 missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 30894013 missense probably damaging 0.97
R3418:Agbl5 UTSW 5 30904723 missense probably damaging 1.00
R4827:Agbl5 UTSW 5 30895814 missense probably damaging 1.00
R4828:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R4830:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R5017:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5036:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5038:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5052:Agbl5 UTSW 5 30891214 missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5073:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5074:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5081:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5083:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5103:Agbl5 UTSW 5 30894001 missense probably damaging 1.00
R5107:Agbl5 UTSW 5 30892478 missense probably damaging 1.00
R5130:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5395:Agbl5 UTSW 5 30890338 missense probably damaging 1.00
R5522:Agbl5 UTSW 5 30893903 unclassified probably null
R5524:Agbl5 UTSW 5 30893903 unclassified probably null
R5526:Agbl5 UTSW 5 30893903 unclassified probably null
R5657:Agbl5 UTSW 5 30894046 missense probably damaging 1.00
R5790:Agbl5 UTSW 5 30894358 nonsense probably null
R6301:Agbl5 UTSW 5 30891833 missense probably damaging 1.00
R6891:Agbl5 UTSW 5 30895178 missense probably damaging 1.00
R6919:Agbl5 UTSW 5 30904717 missense probably benign 0.13
R7388:Agbl5 UTSW 5 30903239 nonsense probably null
R7392:Agbl5 UTSW 5 30890771 critical splice donor site probably null
R7410:Agbl5 UTSW 5 30890688 missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 30893391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTAGAAGCCAAGTTCAGGAAC -3'
(R):5'- GTGGGCAACTCAGGTTTCAG -3'

Sequencing Primer
(F):5'- CAGGAACTTATCAAACTGGTTGG -3'
(R):5'- CAACTCAGGTTTCAGGGGCAG -3'
Posted On2016-06-06