Incidental Mutation 'R5018:Ugt2b1'
ID389050
Institutional Source Beutler Lab
Gene Symbol Ugt2b1
Ensembl Gene ENSMUSG00000035836
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B1
Synonyms1300012D20Rik
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86916638-86926530 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 86925962 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 179 (Y179*)
Ref Sequence ENSEMBL: ENSMUSP00000031183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031183]
Predicted Effect probably null
Transcript: ENSMUST00000031183
AA Change: Y179*
SMART Domains Protein: ENSMUSP00000031183
Gene: ENSMUSG00000035836
AA Change: Y179*

DomainStartEndE-ValueType
Pfam:UDPGT 24 527 4.7e-260 PFAM
Pfam:Glyco_tran_28_C 343 454 1.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102029
Meta Mutation Damage Score 0.694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Copy number variation in this gene is associated with susceptibility to osteoporosis.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Ugt2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Ugt2b1 APN 5 86925958 missense probably benign 0.05
IGL00556:Ugt2b1 APN 5 86926196 missense probably benign 0.00
IGL02591:Ugt2b1 APN 5 86917704 missense probably damaging 1.00
IGL02795:Ugt2b1 APN 5 86917701 missense probably damaging 1.00
IGL02993:Ugt2b1 APN 5 86921991 missense possibly damaging 0.86
IGL03057:Ugt2b1 APN 5 86926341 missense possibly damaging 0.59
IGL03084:Ugt2b1 APN 5 86926384 missense probably benign 0.00
PIT4531001:Ugt2b1 UTSW 5 86926483 missense probably benign 0.00
R0125:Ugt2b1 UTSW 5 86926102 missense probably benign
R0480:Ugt2b1 UTSW 5 86926456 missense probably benign 0.00
R0551:Ugt2b1 UTSW 5 86926084 missense probably benign 0.01
R0601:Ugt2b1 UTSW 5 86917680 missense possibly damaging 0.53
R0626:Ugt2b1 UTSW 5 86925861 missense probably null 0.13
R1238:Ugt2b1 UTSW 5 86926129 missense probably benign 0.00
R1623:Ugt2b1 UTSW 5 86926408 missense probably benign 0.25
R1919:Ugt2b1 UTSW 5 86926000 missense probably benign 0.00
R1930:Ugt2b1 UTSW 5 86917841 missense probably damaging 1.00
R1931:Ugt2b1 UTSW 5 86917841 missense probably damaging 1.00
R1955:Ugt2b1 UTSW 5 86917713 missense probably damaging 1.00
R3973:Ugt2b1 UTSW 5 86917675 missense probably benign 0.19
R3976:Ugt2b1 UTSW 5 86917675 missense probably benign 0.19
R4115:Ugt2b1 UTSW 5 86926414 missense probably damaging 0.99
R5043:Ugt2b1 UTSW 5 86917644 missense possibly damaging 0.94
R5765:Ugt2b1 UTSW 5 86919406 missense probably benign 0.32
R5959:Ugt2b1 UTSW 5 86925954 missense probably benign 0.42
R5985:Ugt2b1 UTSW 5 86919668 missense possibly damaging 0.56
R6791:Ugt2b1 UTSW 5 86919257 missense probably damaging 1.00
R7380:Ugt2b1 UTSW 5 86917719 missense not run
X0017:Ugt2b1 UTSW 5 86926329 missense probably benign
X0027:Ugt2b1 UTSW 5 86925798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATCACTGTAAAACTGATTCCAGG -3'
(R):5'- GGGCCGAGCAATGAATCTTC -3'

Sequencing Primer
(F):5'- GTAAAACTGATTCCAGGATTTCTCG -3'
(R):5'- CTGCACCTTTGAGTAAAGATGATC -3'
Posted On2016-06-06