Incidental Mutation 'R5018:Dmwd'
ID389054
Institutional Source Beutler Lab
Gene Symbol Dmwd
Ensembl Gene ENSMUSG00000030410
Gene Namedystrophia myotonica-containing WD repeat motif
SynonymsDm9, 59, DMR-N9
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19076227-19082776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19078119 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000104119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032570] [ENSMUST00000035521] [ENSMUST00000076887] [ENSMUST00000108479]
Predicted Effect probably damaging
Transcript: ENSMUST00000032570
AA Change: D166G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035521
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076887
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108479
AA Change: D166G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Dmwd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Dmwd APN 7 19081234 unclassified probably null
IGL01668:Dmwd APN 7 19081155 missense probably damaging 1.00
IGL02705:Dmwd APN 7 19080844 missense probably benign 0.02
IGL03036:Dmwd APN 7 19081129 missense probably damaging 1.00
IGL03133:Dmwd APN 7 19076637 missense probably damaging 1.00
PIT4305001:Dmwd UTSW 7 19080718 missense probably damaging 0.99
R0172:Dmwd UTSW 7 19080342 missense probably damaging 1.00
R1619:Dmwd UTSW 7 19081034 unclassified probably benign
R2055:Dmwd UTSW 7 19076685 missense probably benign 0.34
R2058:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R2403:Dmwd UTSW 7 19081159 missense possibly damaging 0.94
R2922:Dmwd UTSW 7 19076345 missense probably damaging 1.00
R3122:Dmwd UTSW 7 19080695 missense probably damaging 1.00
R4876:Dmwd UTSW 7 19080547 missense probably damaging 1.00
R4937:Dmwd UTSW 7 19081303 critical splice donor site probably null
R5034:Dmwd UTSW 7 19080294 missense probably damaging 1.00
R5165:Dmwd UTSW 7 19078035 intron probably benign
R5265:Dmwd UTSW 7 19080281 missense possibly damaging 0.89
R5559:Dmwd UTSW 7 19080438 missense probably damaging 0.99
R6695:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R7106:Dmwd UTSW 7 19080529 missense probably damaging 1.00
R7208:Dmwd UTSW 7 19080309 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCCTTGAGGTTAACCCTGC -3'
(R):5'- AGTAGCTGTCTGTCACTTGTCC -3'

Sequencing Primer
(F):5'- GAGGTTAACCCTGCTTCCTCTTAG -3'
(R):5'- TTCCAGGCAGCTTAGTGCAG -3'
Posted On2016-06-06