Incidental Mutation 'R5018:Sin3a'
ID389057
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57110891 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 865 (S865T)
Ref Sequence ENSEMBL: ENSMUSP00000126601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
Predicted Effect probably benign
Transcript: ENSMUST00000049169
AA Change: S865T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: S865T

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125333
Predicted Effect probably benign
Transcript: ENSMUST00000167715
AA Change: S865T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: S865T

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167963
Predicted Effect probably benign
Transcript: ENSMUST00000168177
AA Change: S865T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: S865T

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168502
AA Change: S865T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: S865T

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168678
AA Change: S865T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: S865T

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
PIT4519001:Sin3a UTSW 9 57095456 missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R1993:Sin3a UTSW 9 57101199 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2079:Sin3a UTSW 9 57089523 missense probably benign
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4327:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R4979:Sin3a UTSW 9 57118076 missense probably damaging 1.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5395:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5927:Sin3a UTSW 9 57111111 missense probably damaging 1.00
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense probably null 1.00
R7285:Sin3a UTSW 9 57127299 missense possibly damaging 0.57
R7462:Sin3a UTSW 9 57095525 missense probably benign 0.00
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACCATGTGAAGAGGCAAAC -3'
(R):5'- AGGACTATCACTCTTGTCTCGC -3'

Sequencing Primer
(F):5'- CAGGCATTCAGAAAGAGGACAAATAC -3'
(R):5'- ATGCCTAGCACCTCCCG -3'
Posted On2016-06-06