Incidental Mutation 'R5018:Hal'
ID389060
Institutional Source Beutler Lab
Gene Symbol Hal
Ensembl Gene ENSMUSG00000020017
Gene Namehistidine ammonia lyase
Synonymshistidase, Hsd
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93488768-93519304 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 93507551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016031] [ENSMUST00000016031] [ENSMUST00000129421] [ENSMUST00000129421]
Predicted Effect probably benign
Transcript: ENSMUST00000016031
SMART Domains Protein: ENSMUSP00000016031
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
SCOP:d1gkma_ 114 161 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000016031
SMART Domains Protein: ENSMUSP00000016031
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
SCOP:d1gkma_ 114 161 6e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129421
SMART Domains Protein: ENSMUSP00000123336
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
Pfam:DUF3534 3 128 6e-9 PFAM
Pfam:Lyase_aromatic 116 590 1.3e-199 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129421
SMART Domains Protein: ENSMUSP00000123336
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
Pfam:DUF3534 3 128 6e-9 PFAM
Pfam:Lyase_aromatic 116 590 1.3e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152883
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a member of the histidase protein family. The encoded protein is a cytosolic enzyme which catalyzes the first reaction in histidine catabolism. Defects in this protein cause histidinemia, which is characterized by increased histidine in blood, urine, and cerebrospinal fluid. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this gene cause elevated histidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Hal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hal APN 10 93490069 critical splice donor site probably null
IGL01528:Hal APN 10 93497593 missense probably damaging 1.00
IGL01818:Hal APN 10 93490984 missense probably damaging 0.99
IGL01903:Hal APN 10 93500607 splice site probably benign
IGL02152:Hal APN 10 93503542 missense possibly damaging 0.74
IGL02249:Hal APN 10 93497538 missense probably damaging 0.99
IGL02366:Hal APN 10 93503528 missense probably damaging 1.00
IGL02421:Hal APN 10 93503473 missense probably damaging 0.98
IGL02721:Hal APN 10 93507498 nonsense probably null
2k1 UTSW 10 93514143 critical splice donor site probably null
alger UTSW 10 93507551 critical splice donor site probably null
Whittaker UTSW 10 93516284 missense probably benign
R0048:Hal UTSW 10 93498991 missense probably damaging 1.00
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0372:Hal UTSW 10 93507553 splice site probably benign
R0465:Hal UTSW 10 93516284 missense probably benign
R0504:Hal UTSW 10 93489174 missense probably damaging 0.99
R1357:Hal UTSW 10 93500623 missense probably damaging 0.96
R1623:Hal UTSW 10 93516297 missense probably benign 0.00
R1757:Hal UTSW 10 93494628 missense probably benign 0.14
R1918:Hal UTSW 10 93496607 missense probably damaging 1.00
R2048:Hal UTSW 10 93491140 missense probably damaging 0.98
R2291:Hal UTSW 10 93503536 missense probably damaging 0.98
R3001:Hal UTSW 10 93507519 missense probably damaging 1.00
R3002:Hal UTSW 10 93507519 missense probably damaging 1.00
R3927:Hal UTSW 10 93514026 splice site probably benign
R3948:Hal UTSW 10 93489907 missense possibly damaging 0.94
R4394:Hal UTSW 10 93496559 intron probably benign
R4623:Hal UTSW 10 93507439 missense probably damaging 1.00
R4922:Hal UTSW 10 93503539 missense probably damaging 1.00
R5072:Hal UTSW 10 93514042 missense probably damaging 0.99
R5073:Hal UTSW 10 93514042 missense probably damaging 0.99
R5074:Hal UTSW 10 93514042 missense probably damaging 0.99
R5303:Hal UTSW 10 93516365 utr 3 prime probably benign
R5806:Hal UTSW 10 93490984 missense probably damaging 0.97
R5992:Hal UTSW 10 93490916 missense probably damaging 1.00
R6294:Hal UTSW 10 93514143 critical splice donor site probably null
R6370:Hal UTSW 10 93497506 missense probably damaging 1.00
R6747:Hal UTSW 10 93500677 missense probably damaging 1.00
R7142:Hal UTSW 10 93500651 missense possibly damaging 0.85
R7299:Hal UTSW 10 93492561 missense probably benign 0.00
R7301:Hal UTSW 10 93492561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACCCCTGGAGACTTTGG -3'
(R):5'- GAAATCGCTTTAGCCACACTC -3'

Sequencing Primer
(F):5'- CCTGGAGACTTTGGGGGAAC -3'
(R):5'- GCTTTAGCCACACTCCCTCC -3'
Posted On2016-06-06