Incidental Mutation 'R5018:Eea1'
ID389061
Institutional Source Beutler Lab
Gene Symbol Eea1
Ensembl Gene ENSMUSG00000036499
Gene Nameearly endosome antigen 1
SynonymsZFYVE2, B230358H09Rik, A430109M19Rik
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location95940650-96045518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96011037 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 393 (V393A)
Ref Sequence ENSEMBL: ENSMUSP00000061493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053484] [ENSMUST00000218291]
Predicted Effect probably benign
Transcript: ENSMUST00000053484
AA Change: V393A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061493
Gene: ENSMUSG00000036499
AA Change: V393A

DomainStartEndE-ValueType
ZnF_C2H2 41 64 2.2e-2 SMART
low complexity region 98 123 N/A INTRINSIC
low complexity region 135 148 N/A INTRINSIC
low complexity region 389 408 N/A INTRINSIC
low complexity region 480 500 N/A INTRINSIC
low complexity region 573 585 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 748 760 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 947 958 N/A INTRINSIC
low complexity region 996 1010 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1198 1217 N/A INTRINSIC
FYVE 1344 1411 1.99e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218088
Predicted Effect probably benign
Transcript: ENSMUST00000218291
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Eea1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Eea1 APN 10 96031677 missense probably damaging 0.99
IGL01645:Eea1 APN 10 95989589 missense probably damaging 1.00
IGL01646:Eea1 APN 10 95997015 missense probably damaging 0.99
IGL01870:Eea1 APN 10 95973986 missense probably damaging 1.00
IGL02074:Eea1 APN 10 96037487 missense probably damaging 1.00
IGL02229:Eea1 APN 10 96018184 missense probably damaging 1.00
IGL02885:Eea1 APN 10 96041484 missense probably benign 0.04
IGL02971:Eea1 APN 10 96041527 missense probably benign 0.37
IGL03223:Eea1 APN 10 96039611 missense probably damaging 1.00
IGL03355:Eea1 APN 10 96042212 utr 3 prime probably benign
Senior UTSW 10 96011037 missense probably benign
Slump UTSW 10 96036633 missense probably benign 0.00
R0189:Eea1 UTSW 10 95995582 missense possibly damaging 0.86
R0374:Eea1 UTSW 10 96039772 splice site probably benign
R0655:Eea1 UTSW 10 95995598 missense probably benign 0.00
R0883:Eea1 UTSW 10 96021667 missense possibly damaging 0.63
R1219:Eea1 UTSW 10 96010761 splice site probably benign
R1344:Eea1 UTSW 10 95994999 critical splice donor site probably null
R1768:Eea1 UTSW 10 95996960 missense probably damaging 1.00
R1887:Eea1 UTSW 10 96018211 critical splice donor site probably null
R2224:Eea1 UTSW 10 96020012 missense probably damaging 0.99
R2927:Eea1 UTSW 10 96013358 missense probably benign 0.00
R3922:Eea1 UTSW 10 96036633 missense probably benign 0.00
R3950:Eea1 UTSW 10 96042134 missense probably damaging 1.00
R4502:Eea1 UTSW 10 96039565 missense probably benign 0.14
R4647:Eea1 UTSW 10 96028393 missense probably benign
R4876:Eea1 UTSW 10 95995613 missense probably benign 0.07
R5009:Eea1 UTSW 10 96011021 missense probably benign
R5490:Eea1 UTSW 10 96026054 missense probably benign 0.41
R5588:Eea1 UTSW 10 96023910 missense probably benign 0.01
R5791:Eea1 UTSW 10 96019995 missense probably benign 0.24
R5799:Eea1 UTSW 10 96002948 missense possibly damaging 0.81
R5842:Eea1 UTSW 10 96018124 missense probably damaging 1.00
R6332:Eea1 UTSW 10 96041473 missense possibly damaging 0.79
R6376:Eea1 UTSW 10 96038798 missense probably benign 0.01
R6468:Eea1 UTSW 10 96028412 missense probably benign 0.14
R6740:Eea1 UTSW 10 96023993 missense probably benign
R6889:Eea1 UTSW 10 96037478 missense probably benign 0.14
R6904:Eea1 UTSW 10 96002879 splice site probably null
R7269:Eea1 UTSW 10 96018138 missense probably damaging 1.00
R7273:Eea1 UTSW 10 95989631 missense probably benign 0.00
R7398:Eea1 UTSW 10 95995631 missense probably benign
R7400:Eea1 UTSW 10 95995570 missense probably benign 0.02
R7537:Eea1 UTSW 10 95994905 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACACCCACTTAGAGGAGAAGC -3'
(R):5'- CTGCTACAAGCTCCTATGCACC -3'

Sequencing Primer
(F):5'- TCGGAAGACTCTCCAGGCATC -3'
(R):5'- ACAAGCTCCTATGCACCCTGTC -3'
Posted On2016-06-06