Incidental Mutation 'R5018:Ugp2'
ID389062
Institutional Source Beutler Lab
Gene Symbol Ugp2
Ensembl Gene ENSMUSG00000001891
Gene NameUDP-glucose pyrophosphorylase 2
Synonyms
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location21321138-21371201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21331052 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 219 (Y219H)
Ref Sequence ENSEMBL: ENSMUSP00000099939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060895] [ENSMUST00000102875]
Predicted Effect probably damaging
Transcript: ENSMUST00000060895
AA Change: Y208H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056324
Gene: ENSMUSG00000001891
AA Change: Y208H

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
Pfam:UDPGP 43 462 2.1e-197 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102875
AA Change: Y219H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099939
Gene: ENSMUSG00000001891
AA Change: Y219H

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:UDPGP 55 473 3.5e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133343
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is an important intermediary in mammalian carbohydrate interconversions. It transfers a glucose moiety from glucose-1-phosphate to MgUTP and forms UDP-glucose and MgPPi. In liver and muscle tissue, UDP-glucose is a direct precursor of glycogen; in lactating mammary gland it is converted to UDP-galactose which is then converted to lactose. The eukaryotic enzyme has no significant sequence similarity to the prokaryotic enzyme. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Ugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ugp2 APN 11 21354345 missense probably benign
IGL01161:Ugp2 APN 11 21323273 missense possibly damaging 0.82
IGL01759:Ugp2 APN 11 21353447 missense probably benign 0.01
IGL03037:Ugp2 APN 11 21332540 nonsense probably null
IGL03092:Ugp2 APN 11 21329722 splice site probably benign
bittern UTSW 11 21322051 unclassified probably null
PIT4377001:Ugp2 UTSW 11 21370203 start codon destroyed probably null 0.33
R1538:Ugp2 UTSW 11 21333791 missense possibly damaging 0.88
R1658:Ugp2 UTSW 11 21333774 missense probably benign
R1771:Ugp2 UTSW 11 21329915 missense probably damaging 1.00
R1874:Ugp2 UTSW 11 21329048 missense probably damaging 1.00
R1970:Ugp2 UTSW 11 21328942 missense probably damaging 0.99
R2143:Ugp2 UTSW 11 21328949 missense probably benign
R2431:Ugp2 UTSW 11 21329025 missense probably damaging 1.00
R3888:Ugp2 UTSW 11 21353366 missense probably benign 0.01
R4352:Ugp2 UTSW 11 21329026 missense probably damaging 0.99
R6125:Ugp2 UTSW 11 21329815 missense probably damaging 0.97
R6388:Ugp2 UTSW 11 21322051 unclassified probably null
R6466:Ugp2 UTSW 11 21328883 missense probably benign 0.01
R6626:Ugp2 UTSW 11 21331028 missense probably damaging 1.00
R7219:Ugp2 UTSW 11 21323271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTCACAGCGCTTCCCATTG -3'
(R):5'- TCTATGGACAACCTCTGAAACAG -3'

Sequencing Primer
(F):5'- CCATTGGGTGGGTTCATCAG -3'
(R):5'- TGGATACTGGACACTGAACATGCTC -3'
Posted On2016-06-06