Incidental Mutation 'R5018:Apol7b'
ID389066
Institutional Source Beutler Lab
Gene Symbol Apol7b
Ensembl Gene ENSMUSG00000068252
Gene Nameapolipoprotein L 7b
Synonyms
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5018 (G1)
Quality Score96
Status Validated
Chromosome15
Chromosomal Location77422209-77447492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77424716 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 61 (F61L)
Ref Sequence ENSEMBL: ENSMUSP00000086894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089469] [ENSMUST00000229434]
Predicted Effect probably benign
Transcript: ENSMUST00000089469
AA Change: F61L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000086894
Gene: ENSMUSG00000068252
AA Change: F61L

DomainStartEndE-ValueType
Pfam:ApoL 20 82 7.9e-15 PFAM
Pfam:ApoL 77 367 1.9e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229381
Predicted Effect probably benign
Transcript: ENSMUST00000229434
AA Change: F61L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Apol7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Apol7b APN 15 77423914 missense probably damaging 1.00
IGL02081:Apol7b APN 15 77423536 missense possibly damaging 0.83
IGL02350:Apol7b APN 15 77423632 missense probably benign 0.05
IGL02357:Apol7b APN 15 77423632 missense probably benign 0.05
R0506:Apol7b UTSW 15 77425528 missense probably benign 0.02
R1187:Apol7b UTSW 15 77423403 missense possibly damaging 0.94
R1433:Apol7b UTSW 15 77425546 missense probably damaging 1.00
R1978:Apol7b UTSW 15 77423339 missense probably damaging 0.99
R2272:Apol7b UTSW 15 77423710 missense probably damaging 1.00
R4012:Apol7b UTSW 15 77424709 missense probably damaging 0.98
R4485:Apol7b UTSW 15 77423666 missense probably benign
R4571:Apol7b UTSW 15 77423534 missense probably benign 0.01
R4823:Apol7b UTSW 15 77427782 utr 5 prime probably benign
R5944:Apol7b UTSW 15 77423767 missense probably damaging 0.99
R6514:Apol7b UTSW 15 77423926 missense probably benign 0.00
R6519:Apol7b UTSW 15 77423348 missense probably benign 0.01
R6808:Apol7b UTSW 15 77424673 missense probably damaging 1.00
R6904:Apol7b UTSW 15 77423425 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACACTTAACCAGCTTGTCTCTG -3'
(R):5'- TTCCTGTGACCATGGGAAGTTAG -3'

Sequencing Primer
(F):5'- ACCAGCTTGTCTCTGAATATTCAATC -3'
(R):5'- GTAAGTACACTGCAGCTGTCTTCAG -3'
Posted On2016-06-06