Incidental Mutation 'R5018:Polr1c'
ID389072
Institutional Source Beutler Lab
Gene Symbol Polr1c
Ensembl Gene ENSMUSG00000067148
Gene Namepolymerase (RNA) I polypeptide C
SynonymsRPA40, Rpo1-1, 40kDa
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46243920-46248054 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 46247709 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
Predicted Effect probably benign
Transcript: ENSMUST00000087026
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095263
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123311
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124126
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127378
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142706
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect probably benign
Transcript: ENSMUST00000173232
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174392
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of both RNA polymerase I and RNA polymerase III complexes. The encoded protein is part of the Pol core element. Mutations in this gene have been associated with Treacher Collins syndrome (TCS) and hypomyelinating leukodystrophy 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Polr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Polr1c APN 17 46244209 missense probably damaging 1.00
IGL02035:Polr1c APN 17 46246159 missense possibly damaging 0.72
R0068:Polr1c UTSW 17 46244903 missense probably benign 0.00
R0457:Polr1c UTSW 17 46247763 missense probably benign 0.00
R0828:Polr1c UTSW 17 46245064 missense probably damaging 0.96
R0881:Polr1c UTSW 17 46244613 missense possibly damaging 0.69
R1322:Polr1c UTSW 17 46244163 missense possibly damaging 0.74
R1518:Polr1c UTSW 17 46247895 missense possibly damaging 0.89
R3765:Polr1c UTSW 17 46247924 missense probably damaging 0.99
R4212:Polr1c UTSW 17 46246120 missense probably damaging 0.97
R4548:Polr1c UTSW 17 46247809 splice site probably null
R5017:Polr1c UTSW 17 46247709 intron probably benign
R5039:Polr1c UTSW 17 46247709 intron probably benign
R5167:Polr1c UTSW 17 46247709 intron probably benign
R5168:Polr1c UTSW 17 46247709 intron probably benign
R5971:Polr1c UTSW 17 46247709 intron probably benign
R6979:Polr1c UTSW 17 46246169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGATTCAGTGCATCAATG -3'
(R):5'- TTCGCAATGTAAGAGATCGGGG -3'

Sequencing Primer
(F):5'- AGTGCATCAATGATTCCTGACC -3'
(R):5'- TAAGAGATCGGGGCGCGG -3'
Posted On2016-06-06