Incidental Mutation 'R5018:Scd4'
ID389076
Institutional Source Beutler Lab
Gene Symbol Scd4
Ensembl Gene ENSMUSG00000050195
Gene Namestearoyl-coenzyme A desaturase 4
Synonyms
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44333092-44346743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44337609 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 134 (M134K)
Ref Sequence ENSEMBL: ENSMUSP00000059860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058856]
Predicted Effect probably benign
Transcript: ENSMUST00000058856
AA Change: M134K

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000059860
Gene: ENSMUSG00000050195
AA Change: M134K

DomainStartEndE-ValueType
transmembrane domain 65 87 N/A INTRINSIC
Pfam:FA_desaturase 91 311 7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133314
Meta Mutation Damage Score 0.1696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Scd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Scd4 APN 19 44344747 missense possibly damaging 0.54
IGL02824:Scd4 APN 19 44341259 missense probably damaging 1.00
IGL03098:Scd4 UTSW 19 44333492 start codon destroyed possibly damaging 0.92
R0576:Scd4 UTSW 19 44341246 missense probably benign 0.00
R0655:Scd4 UTSW 19 44338968 missense possibly damaging 0.52
R1792:Scd4 UTSW 19 44337574 nonsense probably null
R1925:Scd4 UTSW 19 44341384 missense probably damaging 0.99
R1995:Scd4 UTSW 19 44334178 missense possibly damaging 0.93
R5815:Scd4 UTSW 19 44337564 missense probably damaging 1.00
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6264:Scd4 UTSW 19 44338959 nonsense probably null
R6946:Scd4 UTSW 19 44333514 missense probably null 0.82
Predicted Primers PCR Primer
(F):5'- CTCTCTAACCTCTGAAGAAGAAGCAG -3'
(R):5'- AACTGTTTCCCATCCCGGTG -3'

Sequencing Primer
(F):5'- TAGAGAGTCAGCCAAGGGTCCTC -3'
(R):5'- GTGACTCCCATGCTACGTGAAC -3'
Posted On2016-06-06