Incidental Mutation 'R5020:Phlpp2'
ID389144
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109940082 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1081 (L1081H)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably damaging
Transcript: ENSMUST00000034175
AA Change: L1046H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: L1046H

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179721
AA Change: L1081H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: L1081H

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATACCTCTACCCATGG -3'
(R):5'- ACAGTGTTGTGCTCATCCG -3'

Sequencing Primer
(F):5'- GGGAACACTTGTCATATCTAGAAGC -3'
(R):5'- TGTTGTGCTCATCCGAGGCC -3'
Posted On2016-06-06