Incidental Mutation 'R5020:Spag9'
ID389159
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Namesperm associated antigen 9
Synonymssyd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik
MMRRC Submission 042611-MU
Accession Numbers

Genbank: NM_027569; MGI: 1918084

Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93996091-94126085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94097786 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 544 (I544N)
Ref Sequence ENSEMBL: ENSMUSP00000118850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079] [ENSMUST00000153076]
Predicted Effect probably benign
Transcript: ENSMUST00000024979
AA Change: I756N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: I756N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041956
AA Change: I894N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: I894N

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075695
AA Change: I755N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: I755N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092777
AA Change: I756N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: I756N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103168
AA Change: I751N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: I751N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132079
AA Change: I544N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859
AA Change: I544N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 360 394 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138154
Predicted Effect probably benign
Transcript: ENSMUST00000153076
AA Change: I475N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: I475N

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156019
AA Change: I743N
SMART Domains Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859
AA Change: I743N

DomainStartEndE-ValueType
Pfam:JIP_LZII 240 310 1.1e-32 PFAM
coiled coil region 559 593 N/A INTRINSIC
low complexity region 723 739 N/A INTRINSIC
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 94097866 missense probably benign 0.02
IGL01776:Spag9 APN 11 94116727 splice site probably benign
IGL02095:Spag9 APN 11 94108582 missense probably damaging 1.00
IGL02307:Spag9 APN 11 94102160 critical splice donor site probably null
IGL02417:Spag9 APN 11 94116741 missense probably benign 0.27
IGL02480:Spag9 APN 11 94108587 nonsense probably null
IGL02864:Spag9 APN 11 94106661 missense probably damaging 1.00
IGL02976:Spag9 APN 11 94083953 missense probably benign 0.30
IGL02979:Spag9 APN 11 94097364 missense probably benign
IGL03349:Spag9 APN 11 94093509 missense possibly damaging 0.51
dazzle UTSW 11 94093624 nonsense probably null
R0128:Spag9 UTSW 11 94093539 missense probably damaging 1.00
R0418:Spag9 UTSW 11 94091753 splice site probably benign
R1463:Spag9 UTSW 11 94116837 missense probably damaging 1.00
R1593:Spag9 UTSW 11 94097233 missense probably damaging 1.00
R1605:Spag9 UTSW 11 94048539 missense probably damaging 0.99
R1649:Spag9 UTSW 11 94108452 splice site probably null
R1697:Spag9 UTSW 11 93996565 missense probably benign 0.00
R1952:Spag9 UTSW 11 94097358 missense possibly damaging 0.77
R2011:Spag9 UTSW 11 94092375 nonsense probably null
R2012:Spag9 UTSW 11 94092375 nonsense probably null
R2351:Spag9 UTSW 11 94092900 missense probably damaging 1.00
R2367:Spag9 UTSW 11 94116757 missense probably damaging 1.00
R3027:Spag9 UTSW 11 94086377 missense probably null 1.00
R3766:Spag9 UTSW 11 94060283 intron probably benign
R3777:Spag9 UTSW 11 94099026 critical splice acceptor site probably null
R3937:Spag9 UTSW 11 94044417 missense possibly damaging 0.94
R3937:Spag9 UTSW 11 94044479 missense possibly damaging 0.92
R4417:Spag9 UTSW 11 94060346 intron probably benign
R4445:Spag9 UTSW 11 94097253 missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94114351 critical splice donor site probably null
R4799:Spag9 UTSW 11 94048516 missense possibly damaging 0.87
R4799:Spag9 UTSW 11 94048517 missense probably damaging 0.96
R4816:Spag9 UTSW 11 94048599 intron probably benign
R4843:Spag9 UTSW 11 94097818 missense probably damaging 1.00
R5119:Spag9 UTSW 11 94122722 missense probably damaging 1.00
R5298:Spag9 UTSW 11 94100135 missense probably damaging 1.00
R5304:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5305:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5395:Spag9 UTSW 11 94091751 splice site probably null
R5636:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5638:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5654:Spag9 UTSW 11 94090712 missense probably damaging 1.00
R5779:Spag9 UTSW 11 94114253 missense probably benign 0.20
R5814:Spag9 UTSW 11 94082828 missense possibly damaging 0.94
R5912:Spag9 UTSW 11 94044425 missense probably damaging 0.98
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6269:Spag9 UTSW 11 94044507 missense probably benign 0.05
R6294:Spag9 UTSW 11 94093485 critical splice acceptor site probably null
R6389:Spag9 UTSW 11 94086311 missense probably damaging 1.00
R6420:Spag9 UTSW 11 94086302 missense probably damaging 1.00
R6460:Spag9 UTSW 11 94068975 missense probably damaging 1.00
R6482:Spag9 UTSW 11 94093502 missense possibly damaging 0.94
R6860:Spag9 UTSW 11 94081370 missense probably benign 0.25
R7086:Spag9 UTSW 11 94097864 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGCAATGCCCAGGAGGAG -3'
(R):5'- CCCTCTAAGGATGTCAATTAGTGG -3'

Sequencing Primer
(F):5'- GAGTCAGTGGAGTGGAATTCC -3'
(R):5'- CTAAGGATGTCAATTAGTGGGTATTC -3'
Posted On2016-06-06