Incidental Mutation 'R5021:Eed'
ID389193
Institutional Source Beutler Lab
Gene Symbol Eed
Ensembl Gene ENSMUSG00000030619
Gene Nameembryonic ectoderm development
Synonymsl7Rn5, l(7)5Rn
MMRRC Submission 042612-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5021 (G1)
Quality Score157
Status Validated
Chromosome7
Chromosomal Location89954654-89980983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89972305 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 45 (L45M)
Ref Sequence ENSEMBL: ENSMUSP00000146812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107234] [ENSMUST00000208977]
Predicted Effect probably damaging
Transcript: ENSMUST00000107234
AA Change: L96M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102853
Gene: ENSMUSG00000030619
AA Change: L96M

DomainStartEndE-ValueType
WD40 81 125 1.43e1 SMART
WD40 131 176 2.04e2 SMART
WD40 179 219 1.3e-7 SMART
WD40 222 264 1.61e-3 SMART
WD40 295 332 7.1e1 SMART
Blast:WD40 349 390 1e-17 BLAST
WD40 397 438 4.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208643
Predicted Effect probably damaging
Transcript: ENSMUST00000208977
AA Change: L45M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein interacts with enhancer of zeste 2, the cytoplasmic tail of integrin beta7, immunodeficiency virus type 1 (HIV-1) MA protein, and histone deacetylase proteins. This protein mediates repression of gene activity through histone deacetylation, and may act as a specific regulator of integrin function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are dwarfed and their coat color is dilute. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A T 7: 51,556,185 T242S probably benign Het
B3gnt4 G C 5: 123,510,947 R125P probably damaging Het
Blvrb A C 7: 27,448,118 M1L probably benign Het
Cep112 T A 11: 108,470,328 H169Q possibly damaging Het
Clcn1 A T 6: 42,310,988 K718* probably null Het
Clhc1 A G 11: 29,560,627 N226S probably benign Het
Cpne1 T C 2: 156,098,273 probably benign Het
Cspg4 G A 9: 56,897,730 V1942I probably benign Het
Decr2 A T 17: 26,083,006 L250Q probably damaging Het
Depdc5 A G 5: 32,979,414 T1343A probably damaging Het
Ep300 T A 15: 81,640,023 S1351T unknown Het
Fam184b T A 5: 45,573,262 Q476L probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Ift122 A G 6: 115,864,372 D39G probably benign Het
Igf2bp1 A G 11: 95,974,006 Y206H probably damaging Het
Ighv1-19 T C 12: 114,709,066 I6V probably benign Het
Itm2c T C 1: 85,905,338 I131T probably damaging Het
Kcnd3 A T 3: 105,658,754 D417V probably damaging Het
Klf4 T C 4: 55,530,970 E38G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lct T C 1: 128,300,565 M1064V probably benign Het
Map4 C T 9: 110,038,089 Q265* probably null Het
Mcf2l T G 8: 13,011,808 V893G probably damaging Het
Mlst8 C T 17: 24,477,219 D179N possibly damaging Het
Mup6 T A 4: 59,964,352 N18K probably damaging Het
Nbeal2 G A 9: 110,637,463 R764W probably damaging Het
Ncoa6 A T 2: 155,406,949 S1478R probably benign Het
Pcdhga1 C A 18: 37,663,823 R627S probably damaging Het
Sacm1l A G 9: 123,582,328 D394G probably damaging Het
Schip1 A G 3: 68,495,252 T221A probably benign Het
Slc35c1 A G 2: 92,459,021 Y47H possibly damaging Het
Tspan32 A G 7: 143,014,978 D70G probably damaging Het
Vmn2r68 T C 7: 85,233,734 Y270C possibly damaging Het
Zfp777 A G 6: 48,042,127 V291A probably damaging Het
Other mutations in Eed
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Eed APN 7 89969595 missense possibly damaging 0.71
IGL02232:Eed APN 7 89972285 missense probably damaging 1.00
IGL02740:Eed APN 7 89972256 missense possibly damaging 0.91
R0417:Eed UTSW 7 89971552 nonsense probably null
R1018:Eed UTSW 7 89967811 splice site probably benign
R1581:Eed UTSW 7 89980468 missense possibly damaging 0.53
R3959:Eed UTSW 7 89954941 missense probably benign 0.10
R4774:Eed UTSW 7 89964768 missense probably damaging 1.00
R5238:Eed UTSW 7 89976965 missense probably benign
R5561:Eed UTSW 7 89967793 missense probably damaging 1.00
R5959:Eed UTSW 7 89969627 missense probably damaging 1.00
R6223:Eed UTSW 7 89956287 missense probably damaging 1.00
R6391:Eed UTSW 7 89976941 missense probably benign 0.00
R6502:Eed UTSW 7 89977029 missense probably benign 0.00
R7021:Eed UTSW 7 89980519 missense possibly damaging 0.53
R7054:Eed UTSW 7 89964727 critical splice donor site probably null
R7056:Eed UTSW 7 89970356 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CTGTTAACCCAGTATCCAGAATTG -3'
(R):5'- CAGAAGTCAGTGTGTGCATG -3'

Sequencing Primer
(F):5'- GCTTCCCACAGTTGCAAA -3'
(R):5'- GCTTTGGAAACCTCAAGGC -3'
Posted On2016-06-06