Incidental Mutation 'R5021:Pcdhga1'
ID389210
Institutional Source Beutler Lab
Gene Symbol Pcdhga1
Ensembl Gene ENSMUSG00000103144
Gene Nameprotocadherin gamma subfamily A, 1
Synonyms
MMRRC Submission 042612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5021 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37661793-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37663823 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 627 (R627S)
Ref Sequence ENSEMBL: ENSMUSP00000141367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115661] [ENSMUST00000194190] [ENSMUST00000194544] [ENSMUST00000194888]
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192137
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect possibly damaging
Transcript: ENSMUST00000194190
AA Change: R627S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144
AA Change: R627S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194328
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000194888
AA Change: R627S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141367
Gene: ENSMUSG00000103144
AA Change: R627S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 1.6e-4 SMART
CA 155 240 2.7e-18 SMART
CA 264 345 3.3e-28 SMART
CA 369 450 6.7e-27 SMART
CA 474 560 2e-24 SMART
CA 591 669 2.2e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null/reporter allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A T 7: 51,556,185 T242S probably benign Het
B3gnt4 G C 5: 123,510,947 R125P probably damaging Het
Blvrb A C 7: 27,448,118 M1L probably benign Het
Cep112 T A 11: 108,470,328 H169Q possibly damaging Het
Clcn1 A T 6: 42,310,988 K718* probably null Het
Clhc1 A G 11: 29,560,627 N226S probably benign Het
Cpne1 T C 2: 156,098,273 probably benign Het
Cspg4 G A 9: 56,897,730 V1942I probably benign Het
Decr2 A T 17: 26,083,006 L250Q probably damaging Het
Depdc5 A G 5: 32,979,414 T1343A probably damaging Het
Eed A T 7: 89,972,305 L45M probably damaging Het
Ep300 T A 15: 81,640,023 S1351T unknown Het
Fam184b T A 5: 45,573,262 Q476L probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Ift122 A G 6: 115,864,372 D39G probably benign Het
Igf2bp1 A G 11: 95,974,006 Y206H probably damaging Het
Ighv1-19 T C 12: 114,709,066 I6V probably benign Het
Itm2c T C 1: 85,905,338 I131T probably damaging Het
Kcnd3 A T 3: 105,658,754 D417V probably damaging Het
Klf4 T C 4: 55,530,970 E38G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lct T C 1: 128,300,565 M1064V probably benign Het
Map4 C T 9: 110,038,089 Q265* probably null Het
Mcf2l T G 8: 13,011,808 V893G probably damaging Het
Mlst8 C T 17: 24,477,219 D179N possibly damaging Het
Mup6 T A 4: 59,964,352 N18K probably damaging Het
Nbeal2 G A 9: 110,637,463 R764W probably damaging Het
Ncoa6 A T 2: 155,406,949 S1478R probably benign Het
Sacm1l A G 9: 123,582,328 D394G probably damaging Het
Schip1 A G 3: 68,495,252 T221A probably benign Het
Slc35c1 A G 2: 92,459,021 Y47H possibly damaging Het
Tspan32 A G 7: 143,014,978 D70G probably damaging Het
Vmn2r68 T C 7: 85,233,734 Y270C possibly damaging Het
Zfp777 A G 6: 48,042,127 V291A probably damaging Het
Other mutations in Pcdhga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1074:Pcdhga1 UTSW 18 37825087 splice site probably benign
R1869:Pcdhga1 UTSW 18 37840090 missense probably damaging 0.98
R1871:Pcdhga1 UTSW 18 37840090 missense probably damaging 0.98
R3723:Pcdhga1 UTSW 18 37662992 missense possibly damaging 0.89
R3732:Pcdhga1 UTSW 18 37664123 missense probably benign 0.00
R4243:Pcdhga1 UTSW 18 37663552 missense probably damaging 1.00
R4245:Pcdhga1 UTSW 18 37663552 missense probably damaging 1.00
R4424:Pcdhga1 UTSW 18 37662579 missense probably damaging 0.97
R4898:Pcdhga1 UTSW 18 37662354 missense possibly damaging 0.63
R4941:Pcdhga1 UTSW 18 37662606 missense probably benign 0.10
R5765:Pcdhga1 UTSW 18 37663661 missense probably benign 0.31
R6176:Pcdhga1 UTSW 18 37664229 missense probably benign 0.22
R6380:Pcdhga1 UTSW 18 37662969 missense probably damaging 1.00
R7062:Pcdhga1 UTSW 18 37825077 missense probably damaging 1.00
R7146:Pcdhga1 UTSW 18 37662111 missense probably benign 0.04
R7266:Pcdhga1 UTSW 18 37839975 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TACTGATGGCTCCACTGGTGTG -3'
(R):5'- ATGCAGGAGACTACAGCCAC -3'

Sequencing Primer
(F):5'- TGGAGCTAGCACCTCGATCTG -3'
(R):5'- CCAGGTAGAGTGTCAGGTCTGAATC -3'
Posted On2016-06-06