Incidental Mutation 'R5022:Abca1'
ID389233
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission 042613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5022 (G1)
Quality Score217
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCGACTGC to T at 53041570 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably null
Transcript: ENSMUST00000030010
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149127
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,346,096 I465T probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcb4 T A 5: 8,909,054 probably null Het
Acan T C 7: 79,092,808 probably null Het
Aebp2 G A 6: 140,637,730 R109Q possibly damaging Het
Agfg2 A T 5: 137,660,160 probably null Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
AW551984 A T 9: 39,597,965 N293K probably benign Het
BC028528 T A 3: 95,888,823 probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Birc6 A G 17: 74,692,332 Y4656C probably damaging Het
Bmp3 A G 5: 98,872,824 R369G probably damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Ccdc148 G A 2: 58,827,632 A453V probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Celf2 C T 2: 6,607,847 probably benign Het
Chga T C 12: 102,562,837 W358R probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Crim1 T C 17: 78,280,129 V221A possibly damaging Het
D630003M21Rik A T 2: 158,217,633 S116T probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dmxl1 T A 18: 49,895,127 I2206K probably damaging Het
Dusp7 T A 9: 106,373,741 L355Q probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fbln1 G A 15: 85,237,626 S316N probably damaging Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fn1 T C 1: 71,624,179 Y1050C probably damaging Het
Fsip2 A G 2: 82,979,429 I2031V probably benign Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gm5420 A T 10: 21,691,727 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gm7104 A T 12: 88,285,759 noncoding transcript Het
Gp2 A G 7: 119,449,114 I427T probably damaging Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpr142 A C 11: 114,804,388 S60R probably benign Het
Helz2 T C 2: 181,240,569 R144G probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Irs2 A C 8: 10,987,012 *1322G probably null Het
Keg1 A G 19: 12,719,157 N288S probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Klhl1 G A 14: 96,136,706 P635S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Manea A T 4: 26,336,630 Y215* probably null Het
Mdga2 C T 12: 66,470,760 C100Y possibly damaging Het
Mthfd1 T G 12: 76,294,374 V480G probably damaging Het
Mthfd1 T A 12: 76,301,328 M582K probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nanos1 T C 19: 60,756,980 Y239H probably damaging Het
Nat8 G A 6: 85,830,857 T98I possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Olfr1216 A G 2: 89,014,043 V7A probably damaging Het
Olfr1228 C T 2: 89,249,417 M92I probably benign Het
Olfr164 A T 16: 19,286,059 V228D probably damaging Het
Olfr239 T C 17: 33,199,777 F239S probably damaging Het
Olfr457 A T 6: 42,471,287 V297E possibly damaging Het
Olfr589 G A 7: 103,155,735 P4L probably benign Het
Olfr727 T C 14: 50,127,012 V145A possibly damaging Het
Olfr822 T C 10: 130,074,593 L61P probably damaging Het
Pcdhb14 T A 18: 37,450,170 N776K probably benign Het
Pip5k1c G A 10: 81,310,889 probably null Het
Plk4 G A 3: 40,802,077 probably null Het
Prmt8 A G 6: 127,711,163 Y231H possibly damaging Het
Prpf4b T C 13: 34,883,599 probably benign Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Pwwp2b C T 7: 139,255,578 P312S possibly damaging Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rai14 A G 15: 10,574,506 S789P probably damaging Het
Rbm26 C T 14: 105,144,252 D486N probably damaging Het
Rnf20 A G 4: 49,642,016 probably benign Het
Ros1 A G 10: 52,124,075 V1118A possibly damaging Het
Sema3d A C 5: 12,584,956 Y663S probably damaging Het
Serpina6 A G 12: 103,651,712 W281R probably damaging Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Spats2l G T 1: 57,879,556 V30L probably damaging Het
Spg21 A G 9: 65,475,949 D139G probably damaging Het
Sun3 T C 11: 9,038,314 T3A probably damaging Het
Tcrg-V1 T A 13: 19,340,231 S42T probably benign Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tlk1 A T 2: 70,742,065 N386K probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ucp2 A T 7: 100,498,372 N186I possibly damaging Het
Vmn1r119 A G 7: 21,012,320 S46P probably benign Het
Vmn2r101 A T 17: 19,611,387 probably null Het
Vmn2r105 T A 17: 20,208,414 H800L probably damaging Het
Vmn2r69 T C 7: 85,411,159 M406V possibly damaging Het
Vmn2r84 A G 10: 130,386,548 L601P probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Wap T C 11: 6,637,339 probably benign Het
Wdr11 A G 7: 129,624,711 I744M probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACACAAGAGGTTCTCATTCTCTC -3'
(R):5'- AGGCTACTCATTGCGGAGAC -3'

Sequencing Primer
(F):5'- AAGAGGTTCTCATTCTCTCCACGAC -3'
(R):5'- AGAAAGGTTCTTGGCACATCTG -3'
Posted On2016-06-06