Incidental Mutation 'R0433:Fat1'
ID38929
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene NameFAT atypical cadherin 1
SynonymsmFat1, Fath, 2310038E12Rik
MMRRC Submission 038635-MU
Accession Numbers

Genbank: NM_001081286

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0433 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location44935447-45052257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45024649 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 2244 (T2244K)
Ref Sequence ENSEMBL: ENSMUSP00000149194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
Predicted Effect probably benign
Transcript: ENSMUST00000098796
AA Change: T2221K

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: T2221K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180753
Predicted Effect unknown
Transcript: ENSMUST00000189017
AA Change: T2221K
Predicted Effect probably benign
Transcript: ENSMUST00000191428
AA Change: T2221K

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: T2221K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215588
AA Change: T2244K

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 99% (108/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,303 V199A possibly damaging Het
2410089E03Rik T C 15: 8,216,562 S1473P probably benign Het
Abcb5 T C 12: 118,877,810 M967V probably benign Het
Adcy10 T A 1: 165,552,022 L951Q probably damaging Het
Amer2 A T 14: 60,378,583 S76C probably damaging Het
Atad1 T C 19: 32,698,477 I182M probably benign Het
Bpi A G 2: 158,258,419 D42G probably damaging Het
C7 G T 15: 4,988,916 T815K probably damaging Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Camk1g A G 1: 193,354,058 F165L probably damaging Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccser2 A C 14: 36,918,529 F37L probably damaging Het
Cfap43 A G 19: 47,825,771 F208S probably benign Het
Cfap54 G A 10: 92,979,080 probably benign Het
Cfap69 A C 5: 5,649,853 D62E probably damaging Het
Cnksr2 C A X: 157,888,557 M483I probably benign Het
Cnksr2 A T X: 157,888,558 M483K probably benign Het
Cog8 T C 8: 107,056,478 S60G possibly damaging Het
Col4a3 C T 1: 82,670,219 P484S unknown Het
Col6a4 C T 9: 106,067,994 G974R probably damaging Het
Dbnl T G 11: 5,796,825 probably null Het
Dhcr7 T C 7: 143,840,463 C114R possibly damaging Het
Dnah2 C A 11: 69,459,288 D2340Y probably damaging Het
Dusp10 T A 1: 184,069,196 Y387N probably damaging Het
Eipr1 C T 12: 28,859,331 T199I possibly damaging Het
Emc2 T G 15: 43,497,124 probably null Het
Enpp3 A G 10: 24,820,597 S147P probably benign Het
Fam133b T A 5: 3,558,560 probably benign Het
Fam205c A G 4: 42,874,013 probably benign Het
Fbn1 A G 2: 125,348,215 S1453P possibly damaging Het
Fez2 A T 17: 78,418,047 F13I probably damaging Het
Ggnbp2 T C 11: 84,836,420 K530R probably damaging Het
Gm597 A T 1: 28,777,342 Y536* probably null Het
Gpa33 T C 1: 166,163,761 probably benign Het
Gpr142 T C 11: 114,805,997 I123T probably damaging Het
Il21 T G 3: 37,232,535 I11L possibly damaging Het
Klhl7 A G 5: 24,127,702 E86G probably damaging Het
Klk10 G T 7: 43,781,565 A11S possibly damaging Het
Knl1 A T 2: 119,104,061 D2115V probably damaging Het
Lonp2 A G 8: 86,633,954 D185G probably damaging Het
Lrrc47 T C 4: 154,018,365 probably benign Het
Lrrcc1 A G 3: 14,559,374 I698V probably damaging Het
Lzts2 T C 19: 45,021,676 V83A possibly damaging Het
Melk C A 4: 44,340,614 probably benign Het
Mical1 G A 10: 41,479,490 V150I probably benign Het
Morn3 C A 5: 123,039,333 M129I probably benign Het
Mroh2b T A 15: 4,941,634 D1040E probably benign Het
Mroh5 T C 15: 73,790,028 N438S probably benign Het
Mroh5 T A 15: 73,790,808 Q387L probably damaging Het
Myh15 A G 16: 49,145,236 D1168G probably damaging Het
Nek10 A G 14: 14,860,927 E493G probably benign Het
Nipsnap3a A G 4: 53,000,316 Y227C probably damaging Het
Nlrp9c T A 7: 26,385,819 T112S probably benign Het
Nphp4 T C 4: 152,518,172 V401A probably benign Het
Nr1h2 A G 7: 44,549,987 *365Q probably null Het
Olfr1339 T C 4: 118,735,090 V187A probably benign Het
Olfr474 T C 7: 107,955,262 I207T probably damaging Het
Pacs2 T A 12: 113,056,844 V279D possibly damaging Het
Pdcd2 C T 17: 15,526,384 C171Y probably benign Het
Pde11a T A 2: 76,337,706 D301V possibly damaging Het
Pfpl T G 19: 12,429,475 N363K probably damaging Het
Phf14 T A 6: 11,933,743 S201R probably damaging Het
Pip4k2c G A 10: 127,208,946 P66S probably benign Het
Pou2f3 G T 9: 43,127,398 H392N probably benign Het
Pou3f1 G T 4: 124,658,904 G400C probably damaging Het
Ptprg T C 14: 12,220,620 I1219T probably damaging Het
Rfx6 A G 10: 51,720,028 D435G probably damaging Het
Rhpn2 T A 7: 35,385,474 S598T probably benign Het
Sdccag8 C A 1: 176,844,821 probably null Het
Sec16b C A 1: 157,534,709 Y43* probably null Het
Sele T C 1: 164,049,244 Y30H possibly damaging Het
Sgsm2 C T 11: 74,858,190 probably null Het
Slc45a2 T C 15: 11,025,745 Y394H probably benign Het
Slc4a10 T G 2: 62,289,983 I788S probably benign Het
Slmap A T 14: 26,453,594 L161* probably null Het
Slx4 A T 16: 3,986,018 D977E probably benign Het
Spen A T 4: 141,483,758 M608K unknown Het
St8sia4 G C 1: 95,591,704 T353R probably damaging Het
Stab2 G T 10: 86,843,491 probably benign Het
Stx12 C T 4: 132,858,430 G213D probably damaging Het
Synj2 A T 17: 6,033,848 N270Y probably damaging Het
Tdrd9 C T 12: 112,025,581 R438* probably null Het
Tert T C 13: 73,627,081 Y18H probably damaging Het
Tph1 A T 7: 46,653,821 F244L probably damaging Het
Triobp T C 15: 78,968,201 F852L possibly damaging Het
Trpv1 T C 11: 73,253,008 probably benign Het
Uggt2 A T 14: 119,075,329 probably null Het
Ulk4 A G 9: 121,044,819 I1182T probably benign Het
Uqcc1 A G 2: 155,910,368 Y98H probably damaging Het
Usp25 A G 16: 77,109,217 I854V probably benign Het
Usp50 T C 2: 126,761,544 S361G probably damaging Het
Uspl1 C A 5: 149,214,815 Q743K probably damaging Het
Vmn2r3 A G 3: 64,275,633 V215A possibly damaging Het
Vmn2r61 A T 7: 42,265,911 H94L probably benign Het
Vps37c T C 19: 10,713,029 V285A probably benign Het
Vwa8 T C 14: 79,062,676 V983A probably damaging Het
Wdr78 T C 4: 103,103,253 N67D probably benign Het
Zcchc9 C T 13: 91,805,962 R58H probably benign Het
Zdbf2 T C 1: 63,306,143 V1227A possibly damaging Het
Zfp292 T C 4: 34,839,959 K64E probably damaging Het
Zfp948 A G 17: 21,587,502 T319A probably benign Het
Zp3r T G 1: 130,577,133 probably benign Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45024602 missense possibly damaging 0.93
IGL00157:Fat1 APN 8 44951670 missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45050940 missense probably benign 0.18
IGL00983:Fat1 APN 8 45033390 missense probably damaging 1.00
IGL01089:Fat1 APN 8 45017857 missense probably damaging 1.00
IGL01135:Fat1 APN 8 45024840 missense probably damaging 1.00
IGL01143:Fat1 APN 8 45035532 missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45023949 missense probably damaging 1.00
IGL01376:Fat1 APN 8 45026841 missense probably benign 0.00
IGL01411:Fat1 APN 8 45026800 missense probably damaging 1.00
IGL01443:Fat1 APN 8 45040576 missense probably damaging 1.00
IGL01453:Fat1 APN 8 45051270 missense probably damaging 1.00
IGL01606:Fat1 APN 8 45023049 missense probably benign 0.26
IGL01622:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45040700 missense probably benign 0.05
IGL01735:Fat1 APN 8 45036239 missense probably benign 0.07
IGL01793:Fat1 APN 8 44989112 missense probably benign
IGL01820:Fat1 APN 8 45010502 missense probably damaging 1.00
IGL01969:Fat1 APN 8 44952599 missense probably damaging 0.98
IGL02012:Fat1 APN 8 45027540 missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45023659 missense probably damaging 1.00
IGL02256:Fat1 APN 8 44950332 missense probably damaging 1.00
IGL02273:Fat1 APN 8 44950331 missense probably damaging 1.00
IGL02317:Fat1 APN 8 45025818 missense probably benign 0.33
IGL02324:Fat1 APN 8 45040556 missense probably damaging 1.00
IGL02336:Fat1 APN 8 44951583 missense probably benign 0.16
IGL02442:Fat1 APN 8 44950323 missense probably benign 0.02
IGL02486:Fat1 APN 8 45025072 missense probably benign 0.16
IGL02551:Fat1 APN 8 45051398 missense probably damaging 1.00
IGL02617:Fat1 APN 8 45035591 missense probably benign 0.31
IGL02698:Fat1 APN 8 45023164 missense probably benign
IGL02885:Fat1 APN 8 44989167 missense probably benign 0.01
IGL02904:Fat1 APN 8 45040682 missense probably damaging 1.00
IGL02953:Fat1 APN 8 45024314 missense probably damaging 1.00
IGL03108:Fat1 APN 8 45023614 missense probably damaging 1.00
IGL03153:Fat1 APN 8 45030123 missense possibly damaging 0.83
IGL03183:Fat1 APN 8 44950586 missense probably damaging 0.99
IGL03327:Fat1 APN 8 44950468 missense probably damaging 1.00
IGL03405:Fat1 APN 8 45025241 missense probably damaging 1.00
laggardly UTSW 8 45044464 missense probably damaging 1.00
shrinkage UTSW 8 45018037 missense probably damaging 1.00
F5493:Fat1 UTSW 8 45025480 missense probably damaging 0.99
I2289:Fat1 UTSW 8 45024996 missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45017434 missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45029540 missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45037207 missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45024645 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0078:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R0197:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0328:Fat1 UTSW 8 45023790 missense probably benign 0.35
R0367:Fat1 UTSW 8 45024313 missense probably damaging 1.00
R0371:Fat1 UTSW 8 44951892 missense probably damaging 1.00
R0380:Fat1 UTSW 8 45010123 missense probably damaging 0.97
R0389:Fat1 UTSW 8 44950348 missense probably benign 0.00
R0456:Fat1 UTSW 8 45029534 missense probably damaging 1.00
R0494:Fat1 UTSW 8 44950542 missense probably damaging 1.00
R0506:Fat1 UTSW 8 45022951 missense probably damaging 0.99
R0512:Fat1 UTSW 8 44951332 nonsense probably null
R0624:Fat1 UTSW 8 45051168 missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0723:Fat1 UTSW 8 45026749 missense probably damaging 1.00
R0787:Fat1 UTSW 8 45040555 missense probably damaging 1.00
R0788:Fat1 UTSW 8 45023983 missense probably benign 0.27
R0862:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0864:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0907:Fat1 UTSW 8 45026598 missense probably benign 0.08
R0962:Fat1 UTSW 8 45033326 splice site probably benign
R1051:Fat1 UTSW 8 45044506 missense probably damaging 1.00
R1156:Fat1 UTSW 8 45039890 missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45044279 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1478:Fat1 UTSW 8 45025622 missense probably damaging 0.99
R1482:Fat1 UTSW 8 44953244 missense probably benign 0.04
R1496:Fat1 UTSW 8 45033390 missense probably damaging 1.00
R1498:Fat1 UTSW 8 45025484 nonsense probably null
R1508:Fat1 UTSW 8 45026862 missense probably benign 0.01
R1577:Fat1 UTSW 8 45023383 missense probably benign 0.30
R1646:Fat1 UTSW 8 45018042 missense probably damaging 1.00
R1652:Fat1 UTSW 8 45025178 nonsense probably null
R1656:Fat1 UTSW 8 45025530 nonsense probably null
R1662:Fat1 UTSW 8 44953164 missense probably benign 0.20
R1672:Fat1 UTSW 8 45036835 missense probably damaging 1.00
R1704:Fat1 UTSW 8 45025576 missense probably damaging 1.00
R1708:Fat1 UTSW 8 45024792 missense probably damaging 1.00
R1710:Fat1 UTSW 8 45010482 missense probably benign 0.00
R1812:Fat1 UTSW 8 45036803 missense probably damaging 1.00
R1872:Fat1 UTSW 8 44953304 missense probably benign 0.01
R1872:Fat1 UTSW 8 45038349 missense probably damaging 1.00
R1883:Fat1 UTSW 8 45051147 missense probably benign 0.17
R1893:Fat1 UTSW 8 45023856 missense probably damaging 1.00
R1930:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45033926 missense probably benign 0.00
R1957:Fat1 UTSW 8 45040682 missense probably damaging 1.00
R1999:Fat1 UTSW 8 44952393 missense probably damaging 0.96
R2019:Fat1 UTSW 8 45023746 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45024332 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45026704 missense probably damaging 1.00
R2117:Fat1 UTSW 8 45037463 missense probably benign 0.33
R2196:Fat1 UTSW 8 45024646 missense probably damaging 1.00
R2204:Fat1 UTSW 8 45023700 missense probably damaging 1.00
R2256:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2257:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2409:Fat1 UTSW 8 45040530 splice site probably benign
R2416:Fat1 UTSW 8 45026383 missense probably damaging 1.00
R3021:Fat1 UTSW 8 45044011 missense probably damaging 1.00
R3108:Fat1 UTSW 8 45045173 splice site probably null
R3109:Fat1 UTSW 8 45045173 splice site probably null
R3196:Fat1 UTSW 8 44951868 missense probably benign 0.00
R3683:Fat1 UTSW 8 45017938 missense probably benign
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3733:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45025479 missense probably damaging 0.97
R3905:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3907:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3908:Fat1 UTSW 8 45023035 missense probably benign 0.00
R4060:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4061:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4062:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4063:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4078:Fat1 UTSW 8 44989122 missense probably damaging 0.99
R4105:Fat1 UTSW 8 45036851 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45010437 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45050944 missense probably damaging 1.00
R4161:Fat1 UTSW 8 45036787 missense probably benign 0.00
R4364:Fat1 UTSW 8 44952962 missense probably benign 0.01
R4394:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4395:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4396:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4412:Fat1 UTSW 8 45023599 missense probably damaging 0.99
R4542:Fat1 UTSW 8 45041894 missense probably damaging 1.00
R4591:Fat1 UTSW 8 45026242 missense probably benign
R4606:Fat1 UTSW 8 44950683 missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45025147 missense probably damaging 1.00
R4730:Fat1 UTSW 8 45033477 missense probably damaging 1.00
R4778:Fat1 UTSW 8 45038326 missense probably benign 0.04
R4824:Fat1 UTSW 8 44989114 missense probably damaging 1.00
R4829:Fat1 UTSW 8 45036162 missense probably damaging 1.00
R4832:Fat1 UTSW 8 45013065 missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45012970 missense probably benign 0.15
R4896:Fat1 UTSW 8 44951280 missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45022963 missense probably damaging 0.96
R4941:Fat1 UTSW 8 45036275 missense probably benign 0.00
R5011:Fat1 UTSW 8 45031263 critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45023380 missense probably damaging 1.00
R5112:Fat1 UTSW 8 45024282 missense probably damaging 1.00
R5151:Fat1 UTSW 8 44951814 missense possibly damaging 0.74
R5161:Fat1 UTSW 8 44952512 missense probably benign 0.00
R5162:Fat1 UTSW 8 45025809 missense probably benign 0.02
R5353:Fat1 UTSW 8 45036131 missense probably benign 0.13
R5425:Fat1 UTSW 8 45025885 missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45013053 missense probably damaging 1.00
R5479:Fat1 UTSW 8 45036875 missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45023479 missense probably damaging 0.99
R5569:Fat1 UTSW 8 45039836 missense probably damaging 0.98
R5610:Fat1 UTSW 8 44953072 nonsense probably null
R5734:Fat1 UTSW 8 45051209 missense probably damaging 0.99
R5832:Fat1 UTSW 8 45017423 missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45051129 missense probably benign
R5886:Fat1 UTSW 8 45027681 critical splice donor site probably null
R5886:Fat1 UTSW 8 45033395 missense probably damaging 1.00
R5919:Fat1 UTSW 8 45026873 critical splice donor site probably null
R5930:Fat1 UTSW 8 45044036 missense probably benign 0.10
R5960:Fat1 UTSW 8 45033368 missense probably damaging 1.00
R5988:Fat1 UTSW 8 45029456 missense probably benign 0.00
R6166:Fat1 UTSW 8 44952485 missense probably damaging 1.00
R6184:Fat1 UTSW 8 44953392 missense probably benign 0.00
R6208:Fat1 UTSW 8 45027613 missense probably damaging 0.99
R6351:Fat1 UTSW 8 45033495 missense probably damaging 1.00
R6391:Fat1 UTSW 8 44952342 missense possibly damaging 0.69
R6701:Fat1 UTSW 8 44950681 missense probably damaging 1.00
R6702:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6703:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6704:Fat1 UTSW 8 45024373 missense probably damaging 1.00
R6822:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R6852:Fat1 UTSW 8 45035598 missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45044464 missense probably damaging 1.00
R6885:Fat1 UTSW 8 44952452 missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45051023 missense probably benign 0.00
R6927:Fat1 UTSW 8 45024495 missense probably benign 0.41
R6964:Fat1 UTSW 8 45043945 missense probably damaging 1.00
R7010:Fat1 UTSW 8 44953349 nonsense probably null
R7062:Fat1 UTSW 8 44950216 start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45040775 missense probably benign 0.09
R7071:Fat1 UTSW 8 44989108 missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45031468 missense probably damaging 0.98
R7146:Fat1 UTSW 8 44950925 missense probably benign
R7210:Fat1 UTSW 8 45023503 missense probably damaging 1.00
R7227:Fat1 UTSW 8 45010609 missense probably benign 0.08
R7270:Fat1 UTSW 8 45037438 missense probably damaging 1.00
X0064:Fat1 UTSW 8 45025734 missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45023807 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCCAGATTGGACCTTCTGGCGAC -3'
(R):5'- TGGAGTAAGATGGCTGCACAAACAC -3'

Sequencing Primer
(F):5'- GCGACATTTCTCTGAAGAAGC -3'
(R):5'- CACAAACACAGGAGGGTTATCATTG -3'
Posted On2013-05-23