Incidental Mutation 'R0433:Enpp3'
ID38935
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 3
SynonymsCD203c
MMRRC Submission 038635-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R0433 (G1)
Quality Score214
Status Validated
Chromosome10
Chromosomal Location24772406-24842823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24820597 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 147 (S147P)
Ref Sequence ENSEMBL: ENSMUSP00000151393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000218044] [ENSMUST00000219342] [ENSMUST00000219968] [ENSMUST00000220209]
Predicted Effect probably benign
Transcript: ENSMUST00000020169
AA Change: S147P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: S147P

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217903
Predicted Effect probably benign
Transcript: ENSMUST00000218044
AA Change: S147P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218619
Predicted Effect probably benign
Transcript: ENSMUST00000219342
Predicted Effect probably benign
Transcript: ENSMUST00000219968
Predicted Effect probably benign
Transcript: ENSMUST00000220209
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 99% (108/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,303 V199A possibly damaging Het
2410089E03Rik T C 15: 8,216,562 S1473P probably benign Het
Abcb5 T C 12: 118,877,810 M967V probably benign Het
Adcy10 T A 1: 165,552,022 L951Q probably damaging Het
Amer2 A T 14: 60,378,583 S76C probably damaging Het
Atad1 T C 19: 32,698,477 I182M probably benign Het
Bpi A G 2: 158,258,419 D42G probably damaging Het
C7 G T 15: 4,988,916 T815K probably damaging Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Camk1g A G 1: 193,354,058 F165L probably damaging Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccser2 A C 14: 36,918,529 F37L probably damaging Het
Cfap43 A G 19: 47,825,771 F208S probably benign Het
Cfap54 G A 10: 92,979,080 probably benign Het
Cfap69 A C 5: 5,649,853 D62E probably damaging Het
Cnksr2 C A X: 157,888,557 M483I probably benign Het
Cnksr2 A T X: 157,888,558 M483K probably benign Het
Cog8 T C 8: 107,056,478 S60G possibly damaging Het
Col4a3 C T 1: 82,670,219 P484S unknown Het
Col6a4 C T 9: 106,067,994 G974R probably damaging Het
Dbnl T G 11: 5,796,825 probably null Het
Dhcr7 T C 7: 143,840,463 C114R possibly damaging Het
Dnah2 C A 11: 69,459,288 D2340Y probably damaging Het
Dusp10 T A 1: 184,069,196 Y387N probably damaging Het
Eipr1 C T 12: 28,859,331 T199I possibly damaging Het
Emc2 T G 15: 43,497,124 probably null Het
Fam133b T A 5: 3,558,560 probably benign Het
Fam205c A G 4: 42,874,013 probably benign Het
Fat1 C A 8: 45,024,649 T2244K possibly damaging Het
Fbn1 A G 2: 125,348,215 S1453P possibly damaging Het
Fez2 A T 17: 78,418,047 F13I probably damaging Het
Ggnbp2 T C 11: 84,836,420 K530R probably damaging Het
Gm597 A T 1: 28,777,342 Y536* probably null Het
Gpa33 T C 1: 166,163,761 probably benign Het
Gpr142 T C 11: 114,805,997 I123T probably damaging Het
Il21 T G 3: 37,232,535 I11L possibly damaging Het
Klhl7 A G 5: 24,127,702 E86G probably damaging Het
Klk10 G T 7: 43,781,565 A11S possibly damaging Het
Knl1 A T 2: 119,104,061 D2115V probably damaging Het
Lonp2 A G 8: 86,633,954 D185G probably damaging Het
Lrrc47 T C 4: 154,018,365 probably benign Het
Lrrcc1 A G 3: 14,559,374 I698V probably damaging Het
Lzts2 T C 19: 45,021,676 V83A possibly damaging Het
Melk C A 4: 44,340,614 probably benign Het
Mical1 G A 10: 41,479,490 V150I probably benign Het
Morn3 C A 5: 123,039,333 M129I probably benign Het
Mroh2b T A 15: 4,941,634 D1040E probably benign Het
Mroh5 T C 15: 73,790,028 N438S probably benign Het
Mroh5 T A 15: 73,790,808 Q387L probably damaging Het
Myh15 A G 16: 49,145,236 D1168G probably damaging Het
Nek10 A G 14: 14,860,927 E493G probably benign Het
Nipsnap3a A G 4: 53,000,316 Y227C probably damaging Het
Nlrp9c T A 7: 26,385,819 T112S probably benign Het
Nphp4 T C 4: 152,518,172 V401A probably benign Het
Nr1h2 A G 7: 44,549,987 *365Q probably null Het
Olfr1339 T C 4: 118,735,090 V187A probably benign Het
Olfr474 T C 7: 107,955,262 I207T probably damaging Het
Pacs2 T A 12: 113,056,844 V279D possibly damaging Het
Pdcd2 C T 17: 15,526,384 C171Y probably benign Het
Pde11a T A 2: 76,337,706 D301V possibly damaging Het
Pfpl T G 19: 12,429,475 N363K probably damaging Het
Phf14 T A 6: 11,933,743 S201R probably damaging Het
Pip4k2c G A 10: 127,208,946 P66S probably benign Het
Pou2f3 G T 9: 43,127,398 H392N probably benign Het
Pou3f1 G T 4: 124,658,904 G400C probably damaging Het
Ptprg T C 14: 12,220,620 I1219T probably damaging Het
Rfx6 A G 10: 51,720,028 D435G probably damaging Het
Rhpn2 T A 7: 35,385,474 S598T probably benign Het
Sdccag8 C A 1: 176,844,821 probably null Het
Sec16b C A 1: 157,534,709 Y43* probably null Het
Sele T C 1: 164,049,244 Y30H possibly damaging Het
Sgsm2 C T 11: 74,858,190 probably null Het
Slc45a2 T C 15: 11,025,745 Y394H probably benign Het
Slc4a10 T G 2: 62,289,983 I788S probably benign Het
Slmap A T 14: 26,453,594 L161* probably null Het
Slx4 A T 16: 3,986,018 D977E probably benign Het
Spen A T 4: 141,483,758 M608K unknown Het
St8sia4 G C 1: 95,591,704 T353R probably damaging Het
Stab2 G T 10: 86,843,491 probably benign Het
Stx12 C T 4: 132,858,430 G213D probably damaging Het
Synj2 A T 17: 6,033,848 N270Y probably damaging Het
Tdrd9 C T 12: 112,025,581 R438* probably null Het
Tert T C 13: 73,627,081 Y18H probably damaging Het
Tph1 A T 7: 46,653,821 F244L probably damaging Het
Triobp T C 15: 78,968,201 F852L possibly damaging Het
Trpv1 T C 11: 73,253,008 probably benign Het
Uggt2 A T 14: 119,075,329 probably null Het
Ulk4 A G 9: 121,044,819 I1182T probably benign Het
Uqcc1 A G 2: 155,910,368 Y98H probably damaging Het
Usp25 A G 16: 77,109,217 I854V probably benign Het
Usp50 T C 2: 126,761,544 S361G probably damaging Het
Uspl1 C A 5: 149,214,815 Q743K probably damaging Het
Vmn2r3 A G 3: 64,275,633 V215A possibly damaging Het
Vmn2r61 A T 7: 42,265,911 H94L probably benign Het
Vps37c T C 19: 10,713,029 V285A probably benign Het
Vwa8 T C 14: 79,062,676 V983A probably damaging Het
Wdr78 T C 4: 103,103,253 N67D probably benign Het
Zcchc9 C T 13: 91,805,962 R58H probably benign Het
Zdbf2 T C 1: 63,306,143 V1227A possibly damaging Het
Zfp292 T C 4: 34,839,959 K64E probably damaging Het
Zfp948 A G 17: 21,587,502 T319A probably benign Het
Zp3r T G 1: 130,577,133 probably benign Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24787772 missense probably benign 0.00
IGL00778:Enpp3 APN 10 24798262 missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24774907 missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24805922 nonsense probably null
IGL01642:Enpp3 APN 10 24798269 missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24792025 missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24776794 missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24774002 missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24791983 splice site probably benign
IGL02517:Enpp3 APN 10 24809848 splice site probably benign
IGL02956:Enpp3 APN 10 24774943 splice site probably benign
R0017:Enpp3 UTSW 10 24799153 splice site probably null
R0042:Enpp3 UTSW 10 24774824 missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24776869 missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24804436 missense probably damaging 1.00
R0450:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24795716 missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24784953 splice site probably benign
R1261:Enpp3 UTSW 10 24774934 missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24795782 missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24778789 missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24776771 nonsense probably null
R1966:Enpp3 UTSW 10 24807491 missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24776878 missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24805895 missense probably benign 0.00
R2380:Enpp3 UTSW 10 24776872 missense probably benign
R2410:Enpp3 UTSW 10 24774818 missense probably benign 0.00
R3794:Enpp3 UTSW 10 24831732 splice site probably null
R3896:Enpp3 UTSW 10 24777949 missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24793589 missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24776882 missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24773927 missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24798277 missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24807538 missense probably benign 0.01
R5045:Enpp3 UTSW 10 24776767 missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24809916 missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24808160 missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24778821 missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24774842 missense probably benign 0.37
R6117:Enpp3 UTSW 10 24787852 missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24808191 missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24777957 missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24807453 missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24809870 missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24808166 missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24826195 missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24774047 missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24776884 missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24817844 missense unknown
X0026:Enpp3 UTSW 10 24826242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGTTGACTGTGAATCCACAAG -3'
(R):5'- TTTCTGGATGGAATGGCTTCCCTTC -3'

Sequencing Primer
(F):5'- TCCACAAGGAGTCTGAACTTCTG -3'
(R):5'- CCCTTGTCACTATGTGAGATAGAGC -3'
Posted On2013-05-23