Incidental Mutation 'R5034:Trim50'
ID389438
Institutional Source Beutler Lab
Gene Symbol Trim50
Ensembl Gene ENSMUSG00000053388
Gene Nametripartite motif-containing 50
Synonyms
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135353295-135368005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135367293 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 365 (V365A)
Ref Sequence ENSEMBL: ENSMUSP00000106811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000940] [ENSMUST00000065785] [ENSMUST00000111180] [ENSMUST00000170342]
Predicted Effect probably benign
Transcript: ENSMUST00000000940
SMART Domains Protein: ENSMUSP00000000940
Gene: ENSMUSG00000000916

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 180 189 N/A INTRINSIC
Pfam:Nol1_Nop2_Fmu 219 423 1.1e-32 PFAM
low complexity region 448 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000065785
AA Change: V364A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066662
Gene: ENSMUSG00000053388
AA Change: V364A

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 292 344 1.07e-13 SMART
SPRY 345 473 7.48e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111180
AA Change: V365A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106811
Gene: ENSMUSG00000053388
AA Change: V365A

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 293 345 1.07e-13 SMART
SPRY 346 474 7.48e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141867
Predicted Effect probably benign
Transcript: ENSMUST00000170342
SMART Domains Protein: ENSMUSP00000128370
Gene: ENSMUSG00000000916

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202792
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired secretion of gastric acid with impaired stimulated tubulovesicular dynamics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Trim50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Trim50 APN 5 135363954 missense probably damaging 0.99
IGL01565:Trim50 APN 5 135367501 missense probably benign 0.05
IGL01768:Trim50 APN 5 135363882 missense possibly damaging 0.77
IGL03394:Trim50 APN 5 135363953 missense probably damaging 0.97
PIT4498001:Trim50 UTSW 5 135353477 missense probably damaging 1.00
R0137:Trim50 UTSW 5 135366633 missense probably damaging 1.00
R0694:Trim50 UTSW 5 135353545 missense probably benign
R1797:Trim50 UTSW 5 135353501 missense possibly damaging 0.96
R1806:Trim50 UTSW 5 135358889 missense probably benign 0.00
R4688:Trim50 UTSW 5 135367140 missense probably damaging 1.00
R5334:Trim50 UTSW 5 135367476 missense probably damaging 1.00
R5336:Trim50 UTSW 5 135367476 missense probably damaging 1.00
R5337:Trim50 UTSW 5 135367476 missense probably damaging 1.00
R5689:Trim50 UTSW 5 135353662 missense probably damaging 0.98
R6119:Trim50 UTSW 5 135353420 missense probably benign
R6377:Trim50 UTSW 5 135353600 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCTGGAGCTCTCTAAGG -3'
(R):5'- TGTCCGCAGATCATCAGGAC -3'

Sequencing Primer
(F):5'- CTCTCTAAGGGCAACACAGTGG -3'
(R):5'- CAGATCATCAGGACGGTCAGC -3'
Posted On2016-06-06