Incidental Mutation 'R5036:Gm4781'
ID389542
Institutional Source Beutler Lab
Gene Symbol Gm4781
Ensembl Gene ENSMUSG00000090987
Gene Namepredicted gene 4781
Synonyms
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location100396413-100397063 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to A at 100396989 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167995
SMART Domains Protein: ENSMUSP00000132273
Gene: ENSMUSG00000090987

DomainStartEndE-ValueType
Pfam:FYTT 1 52 6e-8 PFAM
RRM 87 159 9.63e-17 SMART
coiled coil region 209 261 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Gm4781
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Gm4781 APN 10 100396890 exon noncoding transcript
IGL02583:Gm4781 APN 10 100396645 exon noncoding transcript
R0731:Gm4781 UTSW 10 100396777 exon noncoding transcript
R1686:Gm4781 UTSW 10 100396975 exon noncoding transcript
R1836:Gm4781 UTSW 10 100396720 exon noncoding transcript
R2147:Gm4781 UTSW 10 100396552 exon noncoding transcript
R4647:Gm4781 UTSW 10 100397000 exon noncoding transcript
R5039:Gm4781 UTSW 10 100396989 exon noncoding transcript
R5777:Gm4781 UTSW 10 100396969 exon noncoding transcript
R5793:Gm4781 UTSW 10 100396667 exon noncoding transcript
R5966:Gm4781 UTSW 10 100396952 exon noncoding transcript
R6180:Gm4781 UTSW 10 100396487 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGACAGGAACAGCTTCCCAC -3'
(R):5'- CCTAATCAGGTTCTCAGGATCTC -3'

Sequencing Primer
(F):5'- ACCAGTATCCACGTCGTTTTGAC -3'
(R):5'- GATCTCTTCCTTATGCCTTAATGATG -3'
Posted On2016-06-06