Incidental Mutation 'R5037:1700022I11Rik'
ID389561
Institutional Source Beutler Lab
Gene Symbol 1700022I11Rik
Ensembl Gene ENSMUSG00000028451
Gene NameRIKEN cDNA 1700022I11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.031) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location42969604-42983640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42972195 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 509 (H509Q)
Ref Sequence ENSEMBL: ENSMUSP00000030163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030163] [ENSMUST00000139127] [ENSMUST00000185904] [ENSMUST00000190902]
Predicted Effect probably benign
Transcript: ENSMUST00000030163
AA Change: H509Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030163
Gene: ENSMUSG00000028451
AA Change: H509Q

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
internal_repeat_1 322 432 6.53e-5 PROSPERO
low complexity region 434 449 N/A INTRINSIC
low complexity region 507 521 N/A INTRINSIC
low complexity region 599 610 N/A INTRINSIC
internal_repeat_1 622 738 6.53e-5 PROSPERO
low complexity region 847 861 N/A INTRINSIC
low complexity region 897 908 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 944 958 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185904
SMART Domains Protein: ENSMUSP00000140492
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:FAM75 99 149 2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189414
Predicted Effect probably benign
Transcript: ENSMUST00000190902
SMART Domains Protein: ENSMUSP00000140363
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in 1700022I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:1700022I11Rik APN 4 42973982 missense probably benign 0.40
IGL01340:1700022I11Rik APN 4 42971984 missense possibly damaging 0.94
IGL02078:1700022I11Rik APN 4 42972685 missense possibly damaging 0.71
IGL02082:1700022I11Rik APN 4 42970198 missense probably benign 0.00
IGL02993:1700022I11Rik APN 4 42971719 missense probably damaging 0.99
IGL03174:1700022I11Rik APN 4 42970975 missense probably benign 0.00
IGL03188:1700022I11Rik APN 4 42971225 missense possibly damaging 0.56
R0031:1700022I11Rik UTSW 4 42973712 missense probably damaging 0.99
R0179:1700022I11Rik UTSW 4 42972214 missense probably benign 0.00
R0409:1700022I11Rik UTSW 4 42972203 missense probably damaging 0.98
R0422:1700022I11Rik UTSW 4 42972199 missense possibly damaging 0.95
R0462:1700022I11Rik UTSW 4 42973429 missense probably benign
R0467:1700022I11Rik UTSW 4 42972715 missense probably benign
R0677:1700022I11Rik UTSW 4 42970952 nonsense probably null
R0723:1700022I11Rik UTSW 4 42971691 missense probably damaging 0.98
R1479:1700022I11Rik UTSW 4 42972543 missense possibly damaging 0.55
R1586:1700022I11Rik UTSW 4 42971512 missense probably benign 0.03
R1956:1700022I11Rik UTSW 4 42970105 splice site probably null
R2030:1700022I11Rik UTSW 4 42974131 nonsense probably null
R2074:1700022I11Rik UTSW 4 42974171 missense probably benign 0.38
R2162:1700022I11Rik UTSW 4 42972238 missense possibly damaging 0.59
R2419:1700022I11Rik UTSW 4 42974146 missense possibly damaging 0.94
R2939:1700022I11Rik UTSW 4 42972946 missense probably benign 0.04
R3615:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3616:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3981:1700022I11Rik UTSW 4 42971534 missense probably damaging 0.99
R5252:1700022I11Rik UTSW 4 42971706 missense probably benign 0.00
R5526:1700022I11Rik UTSW 4 42972125 missense possibly damaging 0.90
R5642:1700022I11Rik UTSW 4 42971831 missense possibly damaging 0.61
R5935:1700022I11Rik UTSW 4 42971465 missense probably benign
R6082:1700022I11Rik UTSW 4 42972511 missense probably benign 0.27
R6136:1700022I11Rik UTSW 4 42972853 missense probably damaging 0.96
R6361:1700022I11Rik UTSW 4 42972695 missense probably benign 0.05
R6494:1700022I11Rik UTSW 4 42971924 missense possibly damaging 0.94
R6641:1700022I11Rik UTSW 4 42971245 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TATGAAGCTCAGTGGGGCATC -3'
(R):5'- TTCAGTTGAGCCTCAGATCCC -3'

Sequencing Primer
(F):5'- GGGCATCCTAGCATATAAAGGCATTC -3'
(R):5'- CATAGGTGTGGCTTCATAGAAACCC -3'
Posted On2016-06-06