Incidental Mutation 'R5037:Eri2'
ID389574
Institutional Source Beutler Lab
Gene Symbol Eri2
Ensembl Gene ENSMUSG00000030929
Gene Nameexoribonuclease 2
Synonyms4933424N09Rik, Exod1
Accession Numbers

Genbank: NM_027698

Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119768679-119794058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119785674 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 535 (L535F)
Ref Sequence ENSEMBL: ENSMUSP00000120547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033224] [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529] [ENSMUST00000139192] [ENSMUST00000150844]
Predicted Effect probably benign
Transcript: ENSMUST00000033224
Predicted Effect probably benign
Transcript: ENSMUST00000063770
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106526
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106527
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106528
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106529
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133926
Predicted Effect probably benign
Transcript: ENSMUST00000139192
SMART Domains Protein: ENSMUSP00000117940
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
Pfam:RNase_T 21 160 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149598
Predicted Effect probably benign
Transcript: ENSMUST00000150844
AA Change: L535F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120547
Gene: ENSMUSG00000030929
AA Change: L535F

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
low complexity region 362 381 N/A INTRINSIC
Pfam:zf-GRF 592 640 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154828
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Eri2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Eri2 APN 7 119787741 missense probably benign 0.44
IGL00987:Eri2 APN 7 119791166 missense probably damaging 1.00
IGL01139:Eri2 APN 7 119786737 critical splice donor site probably null
IGL01476:Eri2 APN 7 119790249 missense probably damaging 1.00
IGL02019:Eri2 APN 7 119786080 nonsense probably null
IGL02208:Eri2 APN 7 119785935 missense probably benign 0.00
IGL02395:Eri2 APN 7 119787810 missense probably damaging 0.98
IGL02405:Eri2 APN 7 119785482 missense probably damaging 1.00
IGL02646:Eri2 APN 7 119786108 missense possibly damaging 0.87
IGL02659:Eri2 APN 7 119787442 missense probably damaging 0.98
alien UTSW 7 119791174 missense probably damaging 1.00
extraterrestrial UTSW 7 119793916 critical splice donor site probably null
G5030:Eri2 UTSW 7 119786378 missense possibly damaging 0.58
K7894:Eri2 UTSW 7 119785271 missense probably benign 0.39
PIT4434001:Eri2 UTSW 7 119786301 missense probably benign 0.00
R0152:Eri2 UTSW 7 119790383 missense probably damaging 1.00
R0378:Eri2 UTSW 7 119793916 critical splice donor site probably null
R0532:Eri2 UTSW 7 119785983 missense probably benign 0.22
R0630:Eri2 UTSW 7 119786417 missense probably benign 0.27
R1192:Eri2 UTSW 7 119792317 missense probably damaging 1.00
R1416:Eri2 UTSW 7 119791174 missense probably damaging 1.00
R1884:Eri2 UTSW 7 119791123 missense probably benign 0.12
R2173:Eri2 UTSW 7 119786543 missense possibly damaging 0.67
R2961:Eri2 UTSW 7 119785344 missense probably benign
R3805:Eri2 UTSW 7 119786008 nonsense probably null
R3807:Eri2 UTSW 7 119786008 nonsense probably null
R4534:Eri2 UTSW 7 119790243 missense probably damaging 1.00
R4738:Eri2 UTSW 7 119787732 critical splice donor site probably null
R4776:Eri2 UTSW 7 119784946 utr 3 prime probably benign
R4780:Eri2 UTSW 7 119785680 missense probably benign 0.43
R5260:Eri2 UTSW 7 119787846 splice site probably benign
R5315:Eri2 UTSW 7 119786018 missense probably benign 0.00
R5884:Eri2 UTSW 7 119772329 makesense probably null
R5927:Eri2 UTSW 7 119786068 missense probably damaging 1.00
R6937:Eri2 UTSW 7 119786789 missense probably damaging 0.96
R7296:Eri2 UTSW 7 119786516 nonsense probably null
R7302:Eri2 UTSW 7 119786786 missense probably benign 0.38
R7480:Eri2 UTSW 7 119786511 nonsense probably null
R7494:Eri2 UTSW 7 119786081 missense probably damaging 0.99
R7524:Eri2 UTSW 7 119785749 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGCGGTGTCATCTTTCC -3'
(R):5'- TGAAGACCTTCAGGAAACTCC -3'

Sequencing Primer
(F):5'- CAGTCTTCCAAGGCTCCTGTAG -3'
(R):5'- GTGTATAAGAGTCCTCACAGTACAG -3'
Posted On2016-06-06