Incidental Mutation 'R5037:Msh5'
ID389598
Institutional Source Beutler Lab
Gene Symbol Msh5
Ensembl Gene ENSMUSG00000007035
Gene NamemutS homolog 5
SynonymsMut5, G7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35028605-35046745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35032393 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 451 (L451S)
Ref Sequence ENSEMBL: ENSMUSP00000134065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007250] [ENSMUST00000040151] [ENSMUST00000097338] [ENSMUST00000172536] [ENSMUST00000174037] [ENSMUST00000174117] [ENSMUST00000174556] [ENSMUST00000174603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007250
AA Change: L451S

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007250
Gene: ENSMUSG00000007035
AA Change: L451S

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000040151
SMART Domains Protein: ENSMUSP00000047448
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
Pfam:Suppressor_APC 35 114 2.1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097338
AA Change: L451S

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094951
Gene: ENSMUSG00000007035
AA Change: L451S

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172536
AA Change: L451S

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134426
Gene: ENSMUSG00000007035
AA Change: L451S

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
low complexity region 604 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173211
Predicted Effect probably benign
Transcript: ENSMUST00000174026
SMART Domains Protein: ENSMUSP00000134295
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
MUTSac 1 166 4e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174037
SMART Domains Protein: ENSMUSP00000133881
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174117
SMART Domains Protein: ENSMUSP00000134423
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174556
SMART Domains Protein: ENSMUSP00000134061
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174603
AA Change: L451S

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134065
Gene: ENSMUSG00000007035
AA Change: L451S

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 493 1.67e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the MutS family of proteins that play critical roles in DNA mismatch repair and meiotic homologous recombination processes. Mice lacking the encoded protein are viable but sterile, with severe defects in spermatogenesis in males and complete loss of ovarian structures in females. Mutations in a similar gene in humans have been shown to cause common variable immune deficiency (CVID) and immunoglobulin A deficiency. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted chromosome pairing in meiosis I resulting in cell death and sterility. In males, testes size is reduced, and in females, there is a total loss of ovarian structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Msh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Msh5 APN 17 35029881 nonsense probably null
IGL00491:Msh5 APN 17 35030730 missense probably damaging 0.96
IGL01364:Msh5 APN 17 35028769 missense possibly damaging 0.70
R0189:Msh5 UTSW 17 35029654 missense probably null 0.97
R0257:Msh5 UTSW 17 35032864 missense probably damaging 0.99
R0346:Msh5 UTSW 17 35029888 missense probably benign 0.09
R0449:Msh5 UTSW 17 35041482 missense probably benign 0.09
R0645:Msh5 UTSW 17 35039223 missense probably damaging 1.00
R1925:Msh5 UTSW 17 35029952 missense probably benign 0.00
R1929:Msh5 UTSW 17 35044390 missense probably benign 0.24
R1970:Msh5 UTSW 17 35033600 missense probably damaging 0.99
R2025:Msh5 UTSW 17 35032792 missense possibly damaging 0.90
R2038:Msh5 UTSW 17 35046040 missense probably benign 0.12
R2058:Msh5 UTSW 17 35029756 missense probably damaging 0.99
R2271:Msh5 UTSW 17 35044390 missense probably benign 0.24
R2408:Msh5 UTSW 17 35045119 missense probably damaging 1.00
R3079:Msh5 UTSW 17 35046232 missense probably benign 0.41
R4409:Msh5 UTSW 17 35039250 missense probably damaging 0.98
R4513:Msh5 UTSW 17 35030688 missense possibly damaging 0.89
R4878:Msh5 UTSW 17 35038456 missense probably damaging 1.00
R4951:Msh5 UTSW 17 35038420 nonsense probably null
R5063:Msh5 UTSW 17 35042188 splice site probably null
R5064:Msh5 UTSW 17 35043783 intron probably benign
R5103:Msh5 UTSW 17 35029239 missense possibly damaging 0.96
R5872:Msh5 UTSW 17 35029652 critical splice donor site probably null
R6320:Msh5 UTSW 17 35029924 missense probably damaging 0.97
R6869:Msh5 UTSW 17 35041834 intron probably null
R6997:Msh5 UTSW 17 35030002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCTTTTCATCCCTTGG -3'
(R):5'- CTGTCCTTAAACCCAGTGACATG -3'

Sequencing Primer
(F):5'- CTCTTCTGACTCAGGACTGGAAAAG -3'
(R):5'- CCCAGTGACATGAATATCTTTGGTG -3'
Posted On2016-06-06